ID: 1145058197

View in Genome Browser
Species Human (GRCh38)
Location 17:19716663-19716685
Sequence ATGAGTAAGGGGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 1, 2: 5, 3: 73, 4: 790}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145058189_1145058197 -1 Left 1145058189 17:19716641-19716663 CCGTGTCGGTACAGCCTGGCTGA 0: 1
1: 0
2: 0
3: 2
4: 109
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058177_1145058197 27 Left 1145058177 17:19716613-19716635 CCAGCGAGCCACCCCCTGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 335
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058180_1145058197 19 Left 1145058180 17:19716621-19716643 CCACCCCCTGCCTGGGCAGCCCG 0: 1
1: 0
2: 3
3: 59
4: 611
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058184_1145058197 13 Left 1145058184 17:19716627-19716649 CCTGCCTGGGCAGCCCGTGTCGG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058181_1145058197 16 Left 1145058181 17:19716624-19716646 CCCCCTGCCTGGGCAGCCCGTGT 0: 1
1: 0
2: 3
3: 52
4: 569
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058186_1145058197 9 Left 1145058186 17:19716631-19716653 CCTGGGCAGCCCGTGTCGGTACA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058188_1145058197 0 Left 1145058188 17:19716640-19716662 CCCGTGTCGGTACAGCCTGGCTG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058183_1145058197 14 Left 1145058183 17:19716626-19716648 CCCTGCCTGGGCAGCCCGTGTCG 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790
1145058182_1145058197 15 Left 1145058182 17:19716625-19716647 CCCCTGCCTGGGCAGCCCGTGTC 0: 1
1: 1
2: 5
3: 25
4: 359
Right 1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG 0: 1
1: 1
2: 5
3: 73
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145058197 Original CRISPR ATGAGTAAGGGGCAGGAGGA GGG Intronic
900667793 1:3827317-3827339 AGGAGGCTGGGGCAGGAGGATGG - Intronic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900970514 1:5990101-5990123 AGGAGCAAGGAGCAGGTGGAAGG - Intronic
900983272 1:6058730-6058752 ATCAGGAAGGAACAGGAGGAGGG + Intronic
901666513 1:10829221-10829243 AGGAGGCTGGGGCAGGAGGATGG + Intergenic
902038607 1:13475816-13475838 GAGAGTAAGAGGCAGGAGGGAGG + Exonic
902163605 1:14552220-14552242 ATTAATAGGGGGCAGGAGGATGG - Intergenic
902550235 1:17214938-17214960 ACCAGGAAGAGGCAGGAGGAGGG - Intronic
902658363 1:17884934-17884956 GTTAGTAATGGGCAGGTGGAAGG + Intergenic
902922828 1:19677427-19677449 AGGAGGAAGGGGTAGGAGGGAGG - Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903282381 1:22257392-22257414 AGGAGGAAGGGGCAGGGGGAGGG - Intergenic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903515270 1:23906223-23906245 TTTAATAAGGGGCAGGAGGTGGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904273630 1:29366484-29366506 ATGAGGAGGGGTCAGGATGAAGG + Intergenic
904357158 1:29947779-29947801 ATGAGAAAAGGGGAAGAGGAAGG - Intergenic
904402067 1:30263505-30263527 AACAGTCAGGGGCAGGATGAAGG - Intergenic
904458129 1:30659265-30659287 CCCAGTAAGAGGCAGGAGGAGGG + Intergenic
904565311 1:31425134-31425156 AACCCTAAGGGGCAGGAGGAAGG - Intronic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904719729 1:32499086-32499108 CTGAGGAATGGGCAGGAGAAAGG - Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904914396 1:33959614-33959636 AGGAGTCAAGGGCAGCAGGAGGG - Intronic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
906114548 1:43348041-43348063 ATGAGTAAGGGGAAGGGATAAGG - Intronic
906559925 1:46748869-46748891 ATGAGGATGGGGCAGGCTGAGGG - Intergenic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908358464 1:63344883-63344905 ATGATTAAGGGGAAGAAGAAGGG + Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909224527 1:73000857-73000879 ATGAGACAGGGGTAGGAGCATGG + Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
910265222 1:85331218-85331240 ATGAGTAAGAAGCAAGAGAATGG - Intronic
910333018 1:86097568-86097590 AGGAGGAGGGGGGAGGAGGAGGG - Intronic
910854390 1:91680228-91680250 ATGAGGAAGTGGGAGGAGAAAGG - Intergenic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912587686 1:110781404-110781426 AGGACCAAGGGGCTGGAGGAAGG - Intergenic
912651587 1:111444195-111444217 ATAATCAAGGGGCAGGAGGGAGG + Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913322876 1:117601583-117601605 ATGAGAAAGGGGTACGAGGTTGG + Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913939865 1:125091650-125091672 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915128259 1:153680272-153680294 AGGAGGAAGGGGGAGGCGGAAGG - Intronic
915303821 1:154966551-154966573 ATGTGTGGTGGGCAGGAGGAGGG + Intronic
916144875 1:161729441-161729463 ATGAATATGGGGAAGTAGGAAGG + Intergenic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916332068 1:163628325-163628347 AGGAGGGAGGGGGAGGAGGAGGG - Intergenic
916498757 1:165368680-165368702 CGGAGTAAGGGTCAGGAGTAGGG - Intergenic
916818742 1:168377964-168377986 ATGAGGACGGGGCAGCAGAATGG + Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917364608 1:174216164-174216186 ATGGGTAAGGGACATGGGGATGG + Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918139633 1:181709536-181709558 ATGAATGAGGGGCTGGGGGATGG - Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918840236 1:189526376-189526398 ATGAGTAAGCGGAAGTAAGAAGG + Intergenic
919763763 1:201113901-201113923 ATAAGAAAGGGGCACCAGGAAGG + Intergenic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
919928985 1:202208979-202209001 AGGGGTAAGGGGCTGGAGTAAGG - Intronic
920718403 1:208363642-208363664 AAGGGTCAGGGGTAGGAGGAGGG + Intergenic
920890433 1:209979595-209979617 GAGAGTAGGGGGCAGCAGGAGGG - Intronic
921218457 1:212956317-212956339 AGGGCTAGGGGGCAGGAGGAGGG - Intronic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
922143663 1:222916774-222916796 ATGACAAATGGGCAGGAGTAAGG - Intronic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923256364 1:232224853-232224875 ATAAGTAAAAGGGAGGAGGATGG - Intergenic
924539898 1:244970761-244970783 AGGAGGACGGGGCGGGAGGAGGG - Exonic
924708417 1:246516397-246516419 ATGGGTGGGGGGCAGCAGGATGG - Intergenic
924788149 1:247219427-247219449 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
924805028 1:247355105-247355127 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
1063219590 10:3954371-3954393 GTGGGTAGGGGGCAGGGGGAGGG + Intergenic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1063814377 10:9756036-9756058 ATGAGTAAGATGCATGAGCAGGG - Intergenic
1063995226 10:11612000-11612022 CTGAGTAGGGGGCGAGAGGATGG + Intergenic
1064297781 10:14093994-14094016 ATGATAATGGAGCAGGAGGATGG + Intronic
1065229590 10:23583644-23583666 ATGGGTGTGGGGCAAGAGGAGGG - Intergenic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1065970681 10:30803829-30803851 CTGAGTTAGAGGCAGCAGGAGGG + Intergenic
1066488144 10:35868934-35868956 AGGAGGATGAGGCAGGAGGATGG - Intergenic
1066498364 10:35964811-35964833 AGTAGTAAGGGGCAGAGGGAAGG - Intergenic
1066626083 10:37407083-37407105 AGTAGTAAGGGGCAGAGGGAAGG - Intergenic
1067409962 10:46055542-46055564 AGGAGGAAGGGGAAGGAGAAGGG - Intergenic
1067560995 10:47304323-47304345 ATGCGTAAGGGACAGAAGGAAGG + Intronic
1068926121 10:62541036-62541058 ATGAGAAAGGAGCTGGAGGTGGG - Intronic
1069022389 10:63503555-63503577 GGGAGTAAGGGACAGGAGTAAGG - Intergenic
1069101665 10:64330092-64330114 ATGAGCACGGGGCAGGGGCAGGG + Intergenic
1069869337 10:71523677-71523699 ACTGGTGAGGGGCAGGAGGAGGG + Intronic
1069959355 10:72070468-72070490 ATGAGGAAGGAGCAGGGGAAGGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070596451 10:77835928-77835950 GGGAGCAAGGGGCAGGAAGAGGG + Intronic
1070834676 10:79440788-79440810 ATCAGTAAGTGGCAGCAGCAGGG - Intronic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071986478 10:91056056-91056078 ATGAGTGTGGGGTAGGAAGAGGG + Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1073015618 10:100396806-100396828 AGGAGTAATGGGCAGGTGGTAGG + Intergenic
1073026309 10:100489579-100489601 AAGAGTAAGTGGGAGGAGGGCGG + Intronic
1073120502 10:101119742-101119764 AAGAGTGAGGGGCACGAGCAAGG - Intronic
1073433279 10:103500654-103500676 AAGCGTAAGGGGGAGGAGGCTGG - Intronic
1073575980 10:104623894-104623916 AGGAGGCTGGGGCAGGAGGATGG - Intergenic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1074162652 10:110846880-110846902 AGGAGGAAGGGGCAGCAGGAAGG - Intergenic
1074385357 10:113012629-113012651 TTGAGTAAGGAGCTGCAGGAAGG + Intronic
1074486896 10:113893256-113893278 ATGGGTCAGAGGCAGAAGGAGGG + Intronic
1074527924 10:114277851-114277873 AAGATGAGGGGGCAGGAGGAGGG + Intronic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075083781 10:119400744-119400766 AGGAATAAGGGGGATGAGGAAGG + Intronic
1075148041 10:119899985-119900007 AGGAGGAAGGGGCAGGAGAAAGG - Intronic
1075688008 10:124377384-124377406 TTGAGAAAAGGGCACGAGGAAGG - Intergenic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076454085 10:130577385-130577407 AGGAGTGAGGTGCAGGAGGGTGG - Intergenic
1076798328 10:132809460-132809482 GGGAGCGAGGGGCAGGAGGAAGG - Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1078294950 11:10058214-10058236 ATCAGTAAGATTCAGGAGGATGG + Intronic
1078493893 11:11796929-11796951 TTGGGTAGGGGGCAGGGGGAGGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1080304055 11:30817806-30817828 ATGAGTGAGAAGCAGAAGGAAGG + Intergenic
1081176666 11:39935531-39935553 ATGATTAAGGCTCACGAGGAAGG + Intergenic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081962342 11:47147611-47147633 AAGGGAAAGGGGCAGCAGGAAGG + Intronic
1081964173 11:47159550-47159572 AAGAGTAAGGGGGAGGCGGGTGG + Intronic
1082768638 11:57188221-57188243 TTGAGTGAGAGGCAGGAGCAAGG - Exonic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083120631 11:60509626-60509648 ATGAGGGAGGGGGAGGGGGAGGG - Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084712308 11:70851473-70851495 AGGAGAAAGGGGCAGGAGAAAGG - Intronic
1084973403 11:72783412-72783434 ATGAGTAGGTGGCAGGGGGCTGG + Intronic
1085377741 11:76082085-76082107 ATGAGAAAGGGGCTTGTGGAAGG + Intronic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085940107 11:81198168-81198190 AAGATCAAGGGGCAGCAGGAGGG + Intergenic
1086045253 11:82524820-82524842 GTGAGGAAGTGGCAGGAGGGAGG - Intergenic
1086661549 11:89425647-89425669 ATGATTTGGGGGTAGGAGGAGGG + Intronic
1086980536 11:93192372-93192394 ATGAGTGCGGGGGAGGAGTAGGG + Intronic
1088000576 11:104875588-104875610 ATGAATCAGAGGCAGGAGTAGGG + Intergenic
1088327298 11:108614029-108614051 ATGAGGCTGTGGCAGGAGGATGG + Intergenic
1088514014 11:110609138-110609160 CTGGGTAGGGGGCAGGAGGGAGG - Intronic
1088582727 11:111331302-111331324 GGGAGGGAGGGGCAGGAGGAGGG - Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1088750835 11:112841108-112841130 ATGAGTAAGGGGTATGAGTAAGG + Intergenic
1088832006 11:113545010-113545032 ATTACTATAGGGCAGGAGGAAGG - Intergenic
1089162301 11:116448010-116448032 GGGAGAAAGGGGCAAGAGGAAGG - Intergenic
1089612069 11:119674930-119674952 ATCAGAGAGGGGCAGGAGGAAGG - Intronic
1089994913 11:122897326-122897348 AGGAGGCTGGGGCAGGAGGATGG - Intronic
1090576010 11:128104731-128104753 AGGATTAAAGGGCAGGAGAATGG - Intergenic
1090652765 11:128822153-128822175 AGGGGTGAGGGGCAGGAAGAGGG - Intergenic
1090966400 11:131601101-131601123 TTGGGTAAGGGCCAGGAGGCAGG + Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091410392 12:235280-235302 AGGAGGCAGGGGCAGGAGGCAGG + Intronic
1091835582 12:3583439-3583461 ATGAGGGAGAGGCAGGAGGTAGG + Intronic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092954290 12:13535201-13535223 ATGAATCAGGGCCAGGAGAAGGG - Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093886871 12:24471604-24471626 ATGAGGATGGGGGAGGAGCAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095950386 12:47778488-47778510 AGGAGCATGGGGCAGGAGCATGG + Intronic
1096627060 12:52902480-52902502 CTGAGGCAGGGGCAGGAGAATGG - Intronic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1096958895 12:55557433-55557455 AAGGGTGGGGGGCAGGAGGAGGG - Intergenic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097079102 12:56416599-56416621 AAGAGTATGCGGCAGGAAGAAGG - Exonic
1097191656 12:57222347-57222369 AGAAGTAAGGGGCAGGGGGAGGG - Intronic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097917732 12:65038674-65038696 AAGAGTAAGGGCCAGCAGGTAGG + Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1098442059 12:70529313-70529335 ATGAGTTTGGGGCAGGTGTATGG + Intronic
1098461861 12:70741389-70741411 ATCAGTAGTGGGCTGGAGGAAGG + Intronic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100071382 12:90723811-90723833 CTGAGCAAGGGGCAGAAGAATGG - Intergenic
1100165811 12:91916556-91916578 AAGAGTAAATGGCAGGAGAAGGG + Intergenic
1100799497 12:98216454-98216476 ATGAGTAAGGGGTGGGATGGGGG - Intergenic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102469832 12:113153409-113153431 GTGAGTCCGGGGCAGGAGGCTGG + Intronic
1102527235 12:113520617-113520639 ATGAGTAAAGAGCAGAACGAGGG - Intergenic
1102582859 12:113902268-113902290 ATGAGTGGGAGGCAGGAGGGAGG - Intronic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1103257164 12:119551621-119551643 ATGAATGAGAGTCAGGAGGAAGG - Intergenic
1103598916 12:122041657-122041679 AGGAGGCAGAGGCAGGAGGATGG + Intronic
1103721100 12:122975988-122976010 ATGAGTGGGGGGCAGGAAGGAGG - Intronic
1104774751 12:131384637-131384659 ATGGGTCGGGGGCAGGAGCATGG - Intergenic
1105446577 13:20462200-20462222 GGGAGGAGGGGGCAGGAGGAGGG + Intronic
1105457135 13:20551424-20551446 ATGAGTAAGAGGAAGGGAGATGG + Intergenic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106519184 13:30482244-30482266 AAGAGAAAGGGAGAGGAGGAGGG - Intronic
1106707831 13:32300586-32300608 ATGAATAAGGGGCAGGAAGCAGG - Intergenic
1106798433 13:33231505-33231527 ATGAATGAGGGACTGGAGGAGGG + Intronic
1106936606 13:34729480-34729502 GTGAGGCAGGGGCAGAAGGAGGG - Intergenic
1107741175 13:43452262-43452284 AGGGGTGTGGGGCAGGAGGAGGG - Intronic
1108106613 13:47017337-47017359 ATGAGAAACTGGGAGGAGGATGG + Intergenic
1109237618 13:59843948-59843970 ATGAGTGGCGGGCAGGAGGAGGG + Intronic
1109747430 13:66645262-66645284 ATGGGTGATGGGGAGGAGGAAGG - Intronic
1109798703 13:67347215-67347237 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111819660 13:93196927-93196949 ATGACAAGGGGGCAGGAGCATGG + Intergenic
1112010864 13:95292897-95292919 ATGAGTAAGGGGCTGGAAGTGGG + Intronic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112493064 13:99884402-99884424 AGGGGAAAGGGTCAGGAGGAGGG - Intronic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1112966028 13:105195431-105195453 ATGAGTGAGAGGCAGGAGATGGG - Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113909854 13:113836645-113836667 ATAAGGATGGGGGAGGAGGAGGG + Intronic
1114408808 14:22481504-22481526 AAGACGAAGGGGGAGGAGGAAGG + Intergenic
1115405148 14:33006484-33006506 GTGAGTAATTGGCAGGGGGAGGG + Intronic
1116857107 14:49962366-49962388 AGGAGTAAGGGGTAGAAGGGAGG + Intergenic
1117486678 14:56204731-56204753 ATGAGTTAGGGTCTGGAGGGTGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118333332 14:64831227-64831249 TTGAGGAATGGGCAGCAGGAAGG - Intronic
1118738458 14:68719979-68720001 GTGACTCAGAGGCAGGAGGAGGG - Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1121667839 14:95686285-95686307 AGGAGGAAGGGGGAGGAGGGAGG - Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121936660 14:98025887-98025909 ATGAGCAAGGGGTAGAGGGATGG - Intergenic
1122383129 14:101324363-101324385 ATGAGTCAGTGGCAGTGGGATGG - Intergenic
1123033686 14:105463135-105463157 AGCAGGAAGGGGCAGGAGGCAGG - Intronic
1123106089 14:105841703-105841725 ATGGGTCAGGGGCAGGCTGAGGG - Intergenic
1123192055 14:106580873-106580895 CTGATTAAGGGGCCTGAGGATGG - Intergenic
1202856922 14_GL000225v1_random:57772-57794 AAGAGGAAGGGGCAGGGCGAAGG - Intergenic
1123396224 15:19939793-19939815 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1123739519 15:23223099-23223121 AGGAGGCTGGGGCAGGAGGATGG - Intergenic
1124290740 15:28452071-28452093 AGGAGGCTGGGGCAGGAGGATGG - Intergenic
1124292496 15:28465487-28465509 AGGAGGCTGGGGCAGGAGGATGG + Intergenic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1125591810 15:40858957-40858979 TTGAGTAAGCGGCAGGGGGTGGG + Intergenic
1125953444 15:43773591-43773613 AGGAGAATGGGGCAGGAGAATGG + Intronic
1126504998 15:49394756-49394778 GTGAGTTAGGAGCAGTAGGAAGG + Intronic
1127281317 15:57496053-57496075 ATGAGTGAAAGACAGGAGGAGGG + Intronic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1127908107 15:63392191-63392213 AGGAGTGAGTGGGAGGAGGATGG - Intergenic
1128156046 15:65392460-65392482 ATGAGGAAGAGACAGGAAGATGG + Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1129367416 15:75064849-75064871 AAGATCAAGGGGCAGCAGGAGGG + Intronic
1129787618 15:78320075-78320097 ATGGGGAAGGGACAGGAGGTAGG + Intergenic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1130232875 15:82109866-82109888 CTTAGTAAGGGTCAGGTGGAGGG + Intergenic
1130256738 15:82329320-82329342 TGGAGTAAGGTGCATGAGGATGG + Intergenic
1130397927 15:83520636-83520658 TTGAGGAAGGGGCTGAAGGAAGG + Intronic
1130433831 15:83875831-83875853 ATGTGTAAGACACAGGAGGAAGG + Intronic
1130598212 15:85260668-85260690 TGGAGTAAGGTGCATGAGGATGG - Intergenic
1130626759 15:85523424-85523446 CTGAGTAAGGGCCTGAAGGAAGG - Intronic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130686360 15:86041210-86041232 AGGAGGAAGGGGCAGCAGGTGGG + Intergenic
1130721079 15:86386211-86386233 AGGAGGAAGGGGGAGGAGGGAGG - Intronic
1130899782 15:88198668-88198690 CTGAGCATGGGGCACGAGGAGGG - Intronic
1131284727 15:91047849-91047871 ATGAGGAAGGAGGAGGAGTAGGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1132078598 15:98845404-98845426 AAGAGGGAGGGGGAGGAGGAGGG - Intronic
1132524774 16:408610-408632 AGGAGGCTGGGGCAGGAGGATGG - Intronic
1132845981 16:2001096-2001118 AGGAGTGAGGATCAGGAGGAAGG - Exonic
1132945435 16:2529434-2529456 ATGAGTAGGGGGCAGGAGTGGGG - Intronic
1133333592 16:4991789-4991811 ATGAGCACGGGGCAGGATGGAGG - Intronic
1133476486 16:6126797-6126819 ATGAGCTAGGAGCTGGAGGAAGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133796844 16:9053157-9053179 ATGAGTAAAATGCAGGAGCACGG + Intergenic
1133898702 16:9953047-9953069 ATGAGGAAGGGCTTGGAGGAGGG + Intronic
1134066613 16:11232494-11232516 AGGAGGAGGGGGGAGGAGGAGGG + Intergenic
1134148622 16:11787988-11788010 AGGAGTATGGGGCTGGACGAGGG - Intronic
1134449400 16:14354225-14354247 AGGAGGAAGGGGGAGGGGGAAGG + Intergenic
1135395056 16:22124900-22124922 ATGAGAATGGGGCAGAAGGTGGG + Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135818025 16:25653701-25653723 AAGAGTAAGGGGATGAAGGAAGG - Intergenic
1135951688 16:26920158-26920180 ATTGGTAAAGGGCAGGAAGAAGG + Intergenic
1136180062 16:28545304-28545326 AGGAGGATGAGGCAGGAGGATGG + Intergenic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136544483 16:30947857-30947879 AGGAGTCAGGGTCAGGGGGAAGG - Exonic
1136698695 16:32111945-32111967 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136768909 16:32815884-32815906 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1136799198 16:33055241-33055263 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1137382926 16:48015196-48015218 AGGAGCAAGGGGCCGGGGGAGGG + Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1137926227 16:52545621-52545643 AGGAGGGAGGAGCAGGAGGAAGG + Intronic
1137940378 16:52677862-52677884 ATGAGTGGGGGACTGGAGGATGG - Intergenic
1139055100 16:63173846-63173868 AAGAGTGAGAAGCAGGAGGAGGG - Intergenic
1139363616 16:66419278-66419300 AGGAGGAATGGGGAGGAGGAGGG + Intergenic
1139424954 16:66873774-66873796 AGGAGGAGGGGGTAGGAGGAGGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139425004 16:66873897-66873919 AGGAGGAGGGGGCAGGAGGAAGG - Intergenic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140328251 16:74026958-74026980 ATGAGTAAGGGAAGAGAGGAAGG + Intergenic
1140332247 16:74069547-74069569 AGGAGTATGGGGCAGGGGCAAGG + Intergenic
1140875403 16:79147243-79147265 ATGAGGCAGGCGCAGAAGGAAGG - Intronic
1141170212 16:81686207-81686229 ATGAGTCAGGGACAGGTGGGAGG + Intronic
1142223560 16:88866605-88866627 ATGGTAGAGGGGCAGGAGGAAGG + Exonic
1203071326 16_KI270728v1_random:1077995-1078017 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1142650193 17:1344713-1344735 AGGAGTGAGGGGAAGGAGGTAGG + Exonic
1143018654 17:3904932-3904954 AGAAGTGAGGGGCAGGGGGAGGG + Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143378422 17:6480658-6480680 TTCAGTCAGGGGCAGGAGGGAGG - Intronic
1143563378 17:7708030-7708052 AGGAGTGAGGGCCAGGAGGCCGG - Exonic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144037553 17:11381207-11381229 AAGAGTAAGGGGTAGGGGAAAGG - Intronic
1144219353 17:13086099-13086121 ACGGGGAGGGGGCAGGAGGAGGG - Intergenic
1144221626 17:13105088-13105110 AAGAGGGAGGGGCAGGACGAAGG - Intergenic
1144994818 17:19260273-19260295 ATGGGAGAGGGCCAGGAGGAAGG + Intronic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145279791 17:21458615-21458637 ATGAGTGAGGGAGAGGAGGGAGG + Intergenic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1145692848 17:26762195-26762217 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1146080702 17:29777883-29777905 ATGAGTAAGGGGCCAGCAGATGG + Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146561055 17:33871093-33871115 AGGAGGAAGGGAGAGGAGGAGGG - Intronic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1146805139 17:35858867-35858889 AGGTGTGAGGGGCAGGAGGCTGG - Exonic
1147042019 17:37726643-37726665 ATGAGCGAGAGGCAGGAGGCAGG + Intronic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147710452 17:42459549-42459571 ATCATTAAAGAGCAGGAGGACGG + Intronic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1147977342 17:44255351-44255373 GTGAATATAGGGCAGGAGGAAGG - Intronic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148210504 17:45805755-45805777 ATGAGTGAGGGGCAGGGAGAGGG - Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148772545 17:50075743-50075765 AGGAGCAAGGGTCAGGATGAGGG + Intronic
1148962351 17:51403876-51403898 ATGAGAAACCGACAGGAGGATGG - Intergenic
1149102891 17:52927722-52927744 ATGGGTAAGGTGCAGGAGCTGGG + Intergenic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149578030 17:57727688-57727710 AGGAGGGAAGGGCAGGAGGAGGG + Intergenic
1150004676 17:61462484-61462506 AAGAGGGAGGGACAGGAGGACGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150416919 17:64995439-64995461 CTGAGGAAGGGACAGAAGGATGG + Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1151215176 17:72572149-72572171 GTGAGTTAGTGGCAGGAGGTGGG - Intergenic
1151502554 17:74500653-74500675 ATGAGTCAGGCGCTGGGGGAGGG + Intergenic
1151762751 17:76115695-76115717 AGGAGAATGAGGCAGGAGGATGG + Intronic
1151775647 17:76199729-76199751 ATGAGCAGGTGGCAGTAGGATGG - Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152457596 17:80425229-80425251 CTCAGTCAGAGGCAGGAGGATGG - Intronic
1152474600 17:80509843-80509865 ATGAGAAAGGCGGAGCAGGAGGG - Intergenic
1152707736 17:81853752-81853774 GGGAGTGAGGGGCAGGAGGGCGG - Intronic
1152815897 17:82407629-82407651 ATGAGGAAGGGGCAGCAGTGGGG - Intronic
1153731811 18:8021510-8021532 AGGAGTGGGGGGCAAGAGGAGGG - Intronic
1153821895 18:8839177-8839199 ACCAGAGAGGGGCAGGAGGAGGG + Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1156084579 18:33382981-33383003 AGGAGGCAGGGGCAGGGGGAGGG + Intronic
1156132277 18:33990674-33990696 ATGATAAAGAGGCAGGAGCAGGG - Intronic
1156480866 18:37435657-37435679 ATGAGGTGGGGGCAGGAAGAAGG - Intronic
1156627835 18:38931161-38931183 ATGAGAAAGGGGCATGATAATGG - Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157261542 18:46179566-46179588 AAAAGTAAGGAGCAGGAGCAGGG + Intronic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1157647653 18:49292967-49292989 GTGGGTAAGGGGCTAGAGGAGGG - Intronic
1158139156 18:54238982-54239004 ATGAGTAAGGGGAAGGAATGAGG - Intergenic
1158445019 18:57511962-57511984 ATGAGTGAGGTGGAGGAGCAAGG + Intergenic
1158450282 18:57557881-57557903 AGGATGAAGTGGCAGGAGGATGG + Intronic
1158525499 18:58209336-58209358 AGGAGGAGGGGGCAGGAGGAGGG - Intronic
1158779847 18:60634976-60634998 ATAAATAATGGGCAAGAGGAGGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159419736 18:68201941-68201963 AAGAGTAAGTGGCAGGAGATAGG + Intergenic
1159682498 18:71372353-71372375 ATGAGTAAGGGGGATGAGGGTGG - Intergenic
1159965096 18:74587431-74587453 ATGTGAAATGGGCAGGAAGATGG - Intergenic
1160048837 18:75412857-75412879 ATGAGACTGGGGGAGGAGGAAGG - Intronic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1160564407 18:79778215-79778237 ATCAGGAAGGGACAGGAGCATGG - Intergenic
1160819776 19:1052515-1052537 AGGAGAAGGGGGGAGGAGGAGGG + Intronic
1160821972 19:1063060-1063082 ATGAGTATGGGGCAGGGCCATGG - Intronic
1161427126 19:4209909-4209931 ATAAGTAAGCGGCAGGAGGCAGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162506157 19:11086542-11086564 ATGAGGCAGAGGCAGGAGAATGG - Intergenic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162777836 19:12990420-12990442 AGCGGTAAGGGGCTGGAGGAAGG - Intergenic
1163023295 19:14495304-14495326 ATGAGTACGGGGTAGGGGGTGGG + Intronic
1163581913 19:18144345-18144367 ATGAGCAAAGGCCAGGAGGCTGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163745348 19:19043437-19043459 TTGAGATGGGGGCAGGAGGAGGG - Intronic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165724017 19:38100151-38100173 GTGAGTCAGGGGCTGGAGGTGGG + Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1166303647 19:41925875-41925897 ATGGGTGAGGGCCAGGAGGCTGG + Intronic
1166397935 19:42456156-42456178 ATGAGAAGGAAGCAGGAGGAGGG - Intergenic
1166569706 19:43785909-43785931 AGGAGGACGAGGCAGGAGGATGG - Intergenic
1166727540 19:45037872-45037894 ATGAGGAAGGGCCAAGGGGATGG - Exonic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167539205 19:50074603-50074625 ATGAGTGAATGACAGGAGGAGGG - Intergenic
1167630502 19:50623255-50623277 ATGAGTGAATGACAGGAGGAGGG + Intronic
1167975316 19:53222058-53222080 ATTAGTAAGGTGAAGGAGGCAGG - Intergenic
1168082458 19:54020255-54020277 ATCAGTTAAGGGCAGCAGGAGGG - Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925414704 2:3661261-3661283 ATGAGCCAGGAGCAGAAGGAAGG - Intronic
925498730 2:4481122-4481144 ATAAGGAAGGGGCAAGGGGAAGG + Intergenic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926192148 2:10736849-10736871 AAGAGTCTGAGGCAGGAGGATGG - Intronic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926393448 2:12417811-12417833 ATGGGGGAGGGGCAGGAGGGAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926650439 2:15338361-15338383 ATAAGTAAGGGTTAGGTGGAGGG - Intronic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927576858 2:24207762-24207784 AGGAGGCAGGGGCAGAAGGATGG + Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932285180 2:70525606-70525628 AGAAGCAAGGGGCAGGAGGAGGG + Intronic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932882447 2:75516454-75516476 ATGAGTATGGGGCAGGAAGGAGG + Intronic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
933040225 2:77455606-77455628 GTGAGAGAGGTGCAGGAGGAGGG - Intronic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933193684 2:79365519-79365541 AGGAGTCTGAGGCAGGAGGATGG + Intronic
933673900 2:85036003-85036025 CTTAGTAAGGGGCAGGGGTAGGG + Intronic
934159101 2:89231107-89231129 TTGAGTTAGGGGCAAGAGGGAGG + Intergenic
934208171 2:89951318-89951340 TTGAGTTAGGGGCAAGAGGGAGG - Intergenic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935163757 2:100551659-100551681 AGGATTCAGGGGCAGGAGGCAGG - Intergenic
935735726 2:106105383-106105405 ATGCGGAGGTGGCAGGAGGAGGG + Intronic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
936112442 2:109676162-109676184 ATGGGTATGGGGCTGGAAGAGGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937084961 2:119165506-119165528 AAGACTAAGGGGCTGGAGGTGGG - Intergenic
937207612 2:120246528-120246550 GTTAGGAAGGGGGAGGAGGAAGG - Intronic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937760172 2:125591180-125591202 GTGGGTAGGGGGCAAGAGGAGGG + Intergenic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
940066413 2:149634737-149634759 AGGATTAAGCGGGAGGAGGAGGG - Intergenic
940797771 2:158098616-158098638 ATGAGCAAGGAGCAAGAGAAGGG - Intronic
941819082 2:169827318-169827340 AGGAGAGAGGGGCGGGAGGAAGG + Intergenic
941824217 2:169875431-169875453 AGGAGTCTGAGGCAGGAGGATGG - Intronic
942147067 2:173037444-173037466 AGGAGTAAGGACTAGGAGGAGGG - Intronic
942588009 2:177507544-177507566 AGAAGTGAGGGGCAGGGGGAAGG - Intronic
942893229 2:181017397-181017419 TTGAGTTAGGGGCATGAGGGGGG + Intronic
944100378 2:196019943-196019965 AAGAAGAAGGGGGAGGAGGAGGG - Intronic
944176094 2:196830794-196830816 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
944217075 2:197267332-197267354 ATTAGAAAGGTGGAGGAGGATGG - Intronic
944553935 2:200869544-200869566 AGGAGGAAGGGGCAGGGGCAAGG + Intergenic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
944875180 2:203957049-203957071 AAGACTAAAGGTCAGGAGGAAGG + Intronic
945158646 2:206865403-206865425 ATGTGCAAGGTGCAGGAGCATGG + Intergenic
945235918 2:207631116-207631138 GGGAGTATGGGGCAGGAGAATGG + Intergenic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
945891780 2:215437135-215437157 GTGAGAAAGGGGCCGAAGGAGGG - Intergenic
946168114 2:217877733-217877755 TTAAGTCAGGGGCAGCAGGAGGG + Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
947712092 2:232322049-232322071 AGCAGTCAGGGGCAGGATGATGG + Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948091850 2:235301939-235301961 ATGAGGAGGGAGCAGGAGGGAGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948538964 2:238672210-238672232 AGGAGGAGGGGGGAGGAGGAGGG - Intergenic
948646575 2:239408780-239408802 ATGAGAAAAGGGCAGGGGTAAGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
949081149 2:242100663-242100685 ATGTGTATGGTGCAGTAGGAGGG + Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168938301 20:1686827-1686849 CTCAGTTCGGGGCAGGAGGAGGG + Intergenic
1169277829 20:4245446-4245468 AAGAGGAAGGGACAGGAGGAGGG + Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169875664 20:10294549-10294571 ATGTGGAAGTTGCAGGAGGATGG - Intronic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172780756 20:37435911-37435933 ATGGGTAGTGGGCAGCAGGAGGG - Intergenic
1172832865 20:37851061-37851083 ATGAGTAAGTGGCTGGAAGAGGG + Intronic
1172842918 20:37912783-37912805 GAGAGTAAGGGGCCGGTGGAGGG - Intronic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172925049 20:38526353-38526375 AAGAGAAAGAGGCAGGAGGAAGG - Intronic
1173103667 20:40111001-40111023 CTCAGTAAGGGGCAGCAGGTAGG + Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173785710 20:45791695-45791717 ATGACTGCGGGGTAGGAGGAAGG - Intronic
1173847012 20:46194490-46194512 TTGGGTATGGGGCTGGAGGATGG + Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174647825 20:52101311-52101333 AAAACTTAGGGGCAGGAGGAGGG + Intronic
1174910376 20:54601672-54601694 ATGATGAAATGGCAGGAGGAGGG + Intronic
1175298274 20:57924284-57924306 ATGAGTGAGTGGCTGGAGCATGG + Intergenic
1175322185 20:58096980-58097002 ATGAATGAGGGGCAGAAGGCAGG - Intergenic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175627314 20:60500323-60500345 ATGAGTTATGGGGATGAGGATGG + Intergenic
1175657792 20:60786987-60787009 AGGAGGAAGGGAGAGGAGGAAGG - Intergenic
1176955006 21:15092084-15092106 AGGAGGCAGAGGCAGGAGGATGG + Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1179037667 21:37773445-37773467 ATGAGTAGGGAGCAGAGGGAAGG + Intronic
1179050811 21:37887292-37887314 ATGAGGATGGGGCTGGGGGAGGG - Intronic
1179168643 21:38955677-38955699 ATGAGTAAGTGTCAGGCTGAGGG - Intergenic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1179812990 21:43884270-43884292 AGGAGGAGGGGGAAGGAGGAGGG - Intronic
1180216261 21:46325137-46325159 ATGACTCGGGGGCAGGAGAAAGG + Intronic
1180572554 22:16741616-16741638 GTTAGTGGGGGGCAGGAGGAGGG - Intergenic
1180595060 22:16967672-16967694 ATGAGGCAGGAGCTGGAGGAAGG - Intronic
1181387686 22:22557822-22557844 AGGAGAAGGGAGCAGGAGGAGGG + Intronic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1182931471 22:34178295-34178317 AGGAGGGAGGGGGAGGAGGAGGG - Intergenic
1182935514 22:34218302-34218324 AGGAGTCAGAGGCAGGAGGGTGG - Intergenic
1183453809 22:37910728-37910750 AAGTGTTGGGGGCAGGAGGAGGG + Intronic
1183546661 22:38457767-38457789 AGGAGGAAGGGGCAGGAAGGAGG + Intergenic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184189552 22:42885736-42885758 AGGAGAAAGGGGCAGGAGTCAGG - Intronic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
949883738 3:8679326-8679348 AAGAGCAAGGGGCGGGAAGAGGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950408679 3:12820354-12820376 ATGATTGAGTGGCAGTAGGAAGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950662937 3:14477823-14477845 GTGAGCAGGGGCCAGGAGGAGGG + Intronic
951425103 3:22535495-22535517 AGGAGGAAGGGGCAGGAAGCAGG + Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
952599897 3:35067455-35067477 AGGAGTATGAGGCAGGAGAATGG - Intergenic
952704010 3:36358573-36358595 ATAAGAAGGGGGTAGGAGGAGGG - Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
952964819 3:38614675-38614697 AAGAGAAAAGGGCAGGATGAGGG + Intronic
952965189 3:38616783-38616805 ATAAGGGAGGGGCAGGAAGAAGG - Intronic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954855570 3:53641122-53641144 AGGAGGAAGGGGCATCAGGAGGG + Intronic
955510923 3:59679524-59679546 ATGAGTAAGAAGGAGGAGGGTGG + Intergenic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
956055749 3:65296819-65296841 AGAAATGAGGGGCAGGAGGAGGG + Intergenic
956064195 3:65379602-65379624 AGGAGGGAGGGGCAGCAGGATGG - Intronic
957105131 3:75877270-75877292 GTTAGTGGGGGGCAGGAGGAGGG + Intergenic
957544960 3:81625087-81625109 ATGAGGGAGGGGGAGGGGGAGGG + Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958682301 3:97346579-97346601 ATTAGTAAGGGAAAGGAGGAAGG + Intronic
958912862 3:100013974-100013996 AGGAGCAAGGGGCAGTGGGAAGG - Intronic
959651750 3:108757157-108757179 ATGAGAAGGAGGCAAGAGGACGG + Exonic
960120817 3:113947742-113947764 AGGAGGCAGGGGCAGGAGGTGGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
961351022 3:126302757-126302779 ATAAGTAAGAAGTAGGAGGATGG - Intergenic
961379112 3:126485956-126485978 AGGAGAAAGGGACAGGAGAATGG + Intronic
961664951 3:128489041-128489063 GTGGGTCGGGGGCAGGAGGAGGG + Intronic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
962335883 3:134529744-134529766 AGGAGGCAGAGGCAGGAGGATGG - Intronic
962381577 3:134902340-134902362 TTGAGTCACTGGCAGGAGGAAGG + Intronic
962389928 3:134962792-134962814 ATGAAGAGGGGGCAGGAGGAGGG - Intronic
962498254 3:135964770-135964792 ATGAGTAAGGAGCATGGGGGTGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
963873661 3:150448063-150448085 AGGAGAAAGGGGTATGAGGAGGG - Intronic
964040198 3:152252247-152252269 AGGAATAAAGGGAAGGAGGAAGG - Intronic
964338897 3:155687745-155687767 ATCAGTCAGTGACAGGAGGATGG - Intronic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
965449253 3:168817315-168817337 CTGATTAAGAGGCAGTAGGAAGG + Intergenic
965861376 3:173155149-173155171 ATGAGTAAAGGAGAGAAGGAAGG - Intergenic
966737382 3:183198428-183198450 GTGAGGGAGGGGCAGGAGAAAGG + Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
966899809 3:184473007-184473029 ATTGGTAAGGGGCAGGGGAAGGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967300117 3:188004497-188004519 AGGAGTACAGGGCAGAAGGATGG - Intergenic
967445301 3:189558922-189558944 ATATGGAAGGGGCAGGAGGGTGG + Intergenic
968124820 3:196151181-196151203 ATGAGTCTGAGGCAGGAGAATGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968202113 3:196763539-196763561 ATCAGTAACTGGCAGGAGAATGG + Intronic
968740653 4:2330097-2330119 AGGGTTAAGGGGCAGGATGAAGG + Intronic
968914191 4:3490029-3490051 ATGAGTAGGAGGAAGAAGGAAGG - Intronic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969850397 4:9952064-9952086 ATCAGTAAGTGGCAGGACCAGGG - Intronic
970088700 4:12378319-12378341 ATGAGTATGGGGAAGAAGGGTGG - Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
972445984 4:39144387-39144409 ATAAGAAAGGGGGAGGAGGGTGG - Intergenic
972661294 4:41119032-41119054 AGGAGGAGGGGGCAGGAAGATGG + Intronic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
973578686 4:52318919-52318941 ATGAGAAAGAGGCAAGAGGTGGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975713796 4:77186810-77186832 ATGAGTGTGGGGTGGGAGGAGGG - Intronic
975850098 4:78563395-78563417 ATGAATAAGGGGCAGGTTGGTGG - Intronic
976241315 4:82960265-82960287 GTGAGTTTGAGGCAGGAGGATGG - Intronic
976344841 4:83988999-83989021 TTGAGGATGGGGCAGAAGGAGGG + Intergenic
976405900 4:84659969-84659991 AGGAGGATGAGGCAGGAGGATGG + Intergenic
977270271 4:94909644-94909666 ATCAGGAAGAGGGAGGAGGAGGG - Intronic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978988313 4:115044677-115044699 ATGAGTAAAAGTCAGCAGGAAGG + Intronic
979525462 4:121711727-121711749 ATGAGTAAGCGGCAGTGGGCGGG + Intergenic
979552766 4:122009700-122009722 AGGACTAAGAGGCAGGAGGAGGG + Intergenic
979970803 4:127132575-127132597 ATGAGGAAGGGGCAGCACAAAGG - Intergenic
980335950 4:131473696-131473718 GGGAGTTGGGGGCAGGAGGAGGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980915810 4:139032247-139032269 ATTAGTCAGTGGCAGGGGGATGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981130805 4:141156383-141156405 AGGAGGATGAGGCAGGAGGATGG - Intronic
981621891 4:146709975-146709997 ATGAGTGGGAGGCAGAAGGAAGG - Intronic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982517951 4:156375629-156375651 AGGGGTGAGGGGCAAGAGGAGGG + Intergenic
983297714 4:165887259-165887281 ATGAGAAAGTGGGAGGAGGGAGG + Intronic
984093834 4:175409694-175409716 ATGAGTATTGGGCAAGAGCAGGG - Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
986352397 5:6892709-6892731 ATGAGTAAGGGATAGGACAAAGG + Intergenic
989403456 5:41034084-41034106 ATGAGTAAGCTGCAGAAGGCAGG + Intronic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
990130658 5:52579118-52579140 AAGAGGAGGGGGCAGGAAGAAGG - Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
991605444 5:68396148-68396170 ATGAGGAAGGGGGAGGGGAAAGG + Intergenic
991959660 5:72031641-72031663 ATGAGCAAGGGTCAAGAGGTGGG - Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
994869696 5:105331659-105331681 AGGAGGGAGGGGGAGGAGGAAGG + Intergenic
995177142 5:109192010-109192032 ATCGGTATGAGGCAGGAGGATGG - Exonic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996086547 5:119310899-119310921 AAGAGTATGGGGAAGGAGAAGGG - Intronic
996872674 5:128208971-128208993 TTGGGTATGTGGCAGGAGGAAGG - Intergenic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
997064896 5:130548733-130548755 AAGATCAAGGGGCAGCAGGAGGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998104176 5:139457710-139457732 ATGGGTGTGGGGCAGGAGCAGGG + Intronic
998173274 5:139884892-139884914 ATAAGAAATGTGCAGGAGGAGGG + Intronic
998495498 5:142584896-142584918 ATGATTCAGGGACAGGAGAAGGG - Intergenic
998623763 5:143822991-143823013 ATGAGCAAAGGCCTGGAGGAGGG + Intergenic
998678272 5:144434968-144434990 AAGAGGAAGGCGCATGAGGAAGG + Intronic
999079970 5:148834028-148834050 ACTAGCAAGGGGCAGGGGGAGGG - Intergenic
999433035 5:151540343-151540365 GAGAGTGAGGGGCAGGAGAAAGG - Intronic
999433044 5:151540387-151540409 GAGAGTGAGGGGCAGGAGAAGGG - Intronic
999433054 5:151540431-151540453 GAGAGTGAGGGGCAGGAGAAGGG - Intronic
999625561 5:153517017-153517039 ATGAGAGAGAGGCAGGAGGTGGG + Intronic
999908491 5:156169835-156169857 ATGAGTAAGGGGGAGTTGGTGGG + Intronic
1000847419 5:166299266-166299288 ATAAGTATGGGGCATGTGGAGGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001867264 5:175116499-175116521 AGGAGAAAGGGAGAGGAGGAAGG - Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1004002053 6:11604828-11604850 AGGAGGAGGGGGAAGGAGGAGGG + Intergenic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004182865 6:13395943-13395965 ATGAGCAGAGGGCAGGCGGAAGG + Intronic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005471559 6:26166406-26166428 AGGAATAAAGGGAAGGAGGAGGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006516212 6:34547034-34547056 ATGTGGACGGGGCAGGAGGCAGG - Intronic
1006704734 6:36009689-36009711 AGGAGTTAGGGACAGGAGGCAGG + Intronic
1006977533 6:38117291-38117313 GTGAGGCAGAGGCAGGAGGATGG - Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008181067 6:48329930-48329952 GTGAGTGAGAGGCAGAAGGATGG + Intergenic
1008234740 6:49030532-49030554 ATGCAGAAGGGACAGGAGGAAGG + Intergenic
1008308727 6:49937958-49937980 ATGAATATGGGGCAGGCAGAGGG + Intergenic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1008980313 6:57475649-57475671 ATTAGTGAGGGGCAGGACGTTGG - Intronic
1009168419 6:60368592-60368614 ATTAGTGAGGGGCAGGACGTTGG - Intergenic
1009292198 6:61896527-61896549 ATGAGTCAGGTTCAGGAGGCAGG - Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009723951 6:67511561-67511583 AGGAGTCTGAGGCAGGAGGATGG - Intergenic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1010445488 6:75944255-75944277 AACAGTGAGGGGAAGGAGGAAGG - Intronic
1011654496 6:89537789-89537811 ATGAGGCTGAGGCAGGAGGATGG + Intronic
1011764071 6:90600539-90600561 ATGAGTGAGGGGCTGGAGACTGG - Intergenic
1011970207 6:93212806-93212828 TTGAGAAAAGGGCAGGAGGTAGG + Intergenic
1012462064 6:99474761-99474783 ATGAGTAAGAGGGAGGAAAATGG + Intronic
1012522099 6:100134317-100134339 ATCAGTAGGGGGCAAGAGCAAGG - Intergenic
1012818288 6:104052894-104052916 ATGAGTAGGGGGAGGAAGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014467153 6:121770782-121770804 AGGAGTTAATGGCAGGAGGAAGG + Intergenic
1014601266 6:123416316-123416338 ATGAGTGAGGAGCAGGTGGTAGG - Intronic
1015277434 6:131398863-131398885 AAGATTTAGGGGCAGGAGGCCGG + Intergenic
1015632203 6:135243066-135243088 ATGAGGCTGGGGCAGGAGGACGG + Intergenic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1016523352 6:144971847-144971869 AGGAGTGGGGGGCTGGAGGAGGG - Intergenic
1016926386 6:149353281-149353303 AGAAGTAAGGGGAAGGAGTAAGG - Intronic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017928477 6:158931072-158931094 AGGAGGCAGAGGCAGGAGGATGG + Intergenic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018083615 6:160279696-160279718 AAGGGTAGGGGGCAAGAGGAAGG - Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018893440 6:167997599-167997621 GTGAGGAAGGGGCAGGGGCAGGG - Intronic
1020080247 7:5282866-5282888 AGGAGGAGGGGGGAGGAGGAGGG + Intronic
1020283177 7:6661686-6661708 AGGAGGATGAGGCAGGAGGATGG - Intergenic
1021316106 7:19149143-19149165 AAGAGGAAGGGACATGAGGAAGG - Intergenic
1021322159 7:19225800-19225822 TTGAGTTAGAGGTAGGAGGAAGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021789889 7:24194282-24194304 AGGAGCAAGAGGGAGGAGGAGGG + Intergenic
1022905930 7:34856825-34856847 ATGATTGAGAGGCAGGAGGAGGG + Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023771117 7:43557437-43557459 ATGTGTGAGGGCCAGGAGAAAGG + Intronic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024721006 7:52137373-52137395 AGGAGGAGGGGGGAGGAGGATGG + Intergenic
1025095030 7:56090070-56090092 ATGAGGAAGGAGCAGTGGGATGG - Intronic
1025730389 7:64102401-64102423 ATGAGGAGGGGGCAGCAGGTTGG - Intronic
1026124718 7:67569435-67569457 ATGAGTGGGTGGGAGGAGGAGGG - Intergenic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026254204 7:68696809-68696831 AAGAGTAAGGGCCAGGAAGATGG - Intergenic
1026292709 7:69022717-69022739 GGGAGTAAGGGGCAAGGGGAGGG - Intergenic
1026566895 7:71496608-71496630 ATGAGGGAGGGTGAGGAGGAAGG + Intronic
1026577912 7:71589465-71589487 ATGAGGCTGAGGCAGGAGGATGG + Intronic
1026777749 7:73241521-73241543 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027018600 7:74794913-74794935 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1027069429 7:75151024-75151046 ATGAGTGAGAGGGAGAAGGAGGG - Intergenic
1027121759 7:75527475-75527497 TTGAGTGTGGGGCAGGGGGAGGG - Intergenic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027759760 7:82262688-82262710 ATGAGTAGGAGACAGGAGGATGG - Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028730846 7:94146852-94146874 ATGAGGGAGGGGGAGGAGCAGGG - Intergenic
1028743879 7:94306313-94306335 CTGAGTAACTGGCAGGGGGAGGG - Intergenic
1028807867 7:95049690-95049712 ATTAGCAATTGGCAGGAGGAAGG - Intronic
1029373783 7:100166186-100166208 AAGAGTAAGGGGCACCTGGAGGG + Intronic
1029598647 7:101550982-101551004 AAGAGGAAGGGAGAGGAGGATGG - Intronic
1030096388 7:105904302-105904324 AGGAGGAAGGGGCAGAAGAAAGG + Intronic
1030162238 7:106520747-106520769 AAGAGGCAGGGGCGGGAGGATGG + Intergenic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1031897564 7:127369000-127369022 AAGAGTAAAGGGGAGGGGGAGGG + Intronic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033048778 7:137985517-137985539 GTGAGTAGGGGACAGCAGGATGG - Intronic
1034439050 7:151077287-151077309 GTGAGCAAGGGGCAGGCGGCAGG - Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1039163429 8:34648770-34648792 AAGAGTAAGGGGTTGGGGGAAGG - Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1040577642 8:48667685-48667707 ATTAGTAAGGGGAAGGGGGCTGG - Intergenic
1041012343 8:53557660-53557682 AACAGTAAAGGGCTGGAGGAGGG + Intergenic
1041085082 8:54249477-54249499 AAGAGCAAGGGTCAGGAGGTGGG - Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041340986 8:56845119-56845141 ATGGGAGAGGGGCAGGAGGCAGG + Intergenic
1041641381 8:60206657-60206679 ATGATGAAGGGGCAGGAGCTAGG - Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043378233 8:79673992-79674014 ATGAGTGGGAGGCAGGGGGAAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043788958 8:84438491-84438513 ATGAGGCTGAGGCAGGAGGATGG - Intronic
1044252680 8:90022507-90022529 TTCAGTGAGGGGCAGGAAGATGG + Intronic
1046554921 8:115762429-115762451 AGGAGTAAGAGGCAGGAAAATGG - Intronic
1047136878 8:122089355-122089377 ATGGGTAAGGGAGTGGAGGAGGG + Intergenic
1047190001 8:122669691-122669713 TTGGGGAAGGGGCAGGATGAGGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047833122 8:128657721-128657743 ATGAGCAAGTGGCAGCAGCAAGG - Intergenic
1048308915 8:133303283-133303305 AGGAGGGAGGGGCAGGAAGAAGG - Intergenic
1049185023 8:141245721-141245743 AGGAGTCAAGGGCAGGGGGAAGG + Intronic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049361118 8:142212993-142213015 AGGAGGGAGGGGGAGGAGGAAGG - Intronic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1050421081 9:5465780-5465802 AGGGGTGAGGGGCAGGAGAATGG + Intronic
1050428732 9:5539618-5539640 CTGAGGAAGGGGCGGGAGCATGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1052902576 9:33806308-33806330 ATGAGGCTGAGGCAGGAGGATGG - Intergenic
1052933906 9:34077473-34077495 AGGAGGCTGGGGCAGGAGGATGG + Intergenic
1053123069 9:35560545-35560567 AAAAGAAAGGGGCAGGAGGTGGG + Exonic
1053365338 9:37518751-37518773 AGGTGTAAGCGGCAGTAGGATGG - Intronic
1053434258 9:38065153-38065175 ATGAGTGAGGGGCAGAAGGAAGG + Intronic
1053696509 9:40644162-40644184 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054307760 9:63443390-63443412 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1054440114 9:65252865-65252887 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1054490291 9:65769074-65769096 ATGAGCAAGGGAGGGGAGGAGGG + Intergenic
1055740538 9:79383281-79383303 ATGAGGCTGAGGCAGGAGGATGG + Intergenic
1056318080 9:85410530-85410552 ATGAGACATGGCCAGGAGGAAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056477503 9:86967245-86967267 AGGAGGAAGGGGGAGCAGGAAGG - Intergenic
1057495780 9:95559936-95559958 AGGAGTGTGGGGGAGGAGGATGG + Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058700002 9:107592040-107592062 ATGAGGAAGGGTGAGGATGAGGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058766765 9:108189468-108189490 AGGAGAAGGGGGTAGGAGGAAGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059153139 9:111967043-111967065 AAGAGTAAGGCTCAGAAGGAAGG + Intergenic
1059228517 9:112695760-112695782 AGGAGGAAGGGAGAGGAGGAGGG + Intronic
1059341236 9:113598680-113598702 ATGAGTAAGGGGAGGCAGGGAGG - Intergenic
1059655684 9:116355256-116355278 AGGAATTAAGGGCAGGAGGAAGG + Intronic
1059897546 9:118883721-118883743 ATGAGGGTGGGGCAGGAGGAGGG + Intergenic
1060488679 9:124065756-124065778 ATCCGTCTGGGGCAGGAGGAGGG - Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061485982 9:130920745-130920767 AGGAGTGAGGGGCAGGGAGACGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062151653 9:135022445-135022467 ATGAGAAAGGCCGAGGAGGAAGG - Intergenic
1062259586 9:135654797-135654819 TTGGGAAAGGGGCGGGAGGAAGG - Intergenic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1202778957 9_KI270717v1_random:17822-17844 ATGAGCAAGGGAGGGGAGGAGGG - Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185874335 X:3689870-3689892 AGGAGGCTGGGGCAGGAGGATGG + Intronic
1186390658 X:9155513-9155535 AAGAGCAAGGGGCTGGAGCATGG - Intronic
1186456218 X:9712112-9712134 AAGAGGAAGAGGCAGGTGGAAGG - Intronic
1187180693 X:16940836-16940858 ATGAGTGAGGGACAGCAGGCTGG - Intergenic
1187782710 X:22846491-22846513 ACAATTAAGGGGCAGGAGGATGG + Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1188501476 X:30831588-30831610 AGGATTAAGGGGGAGGGGGAAGG + Intronic
1188772184 X:34166111-34166133 AGGAGTGGGGGGCAAGAGGAGGG - Intergenic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189437567 X:41006478-41006500 GTGAGGCAGAGGCAGGAGGATGG - Intergenic
1189640399 X:43063753-43063775 AGGAGCAAGGGGCAAGAGGTGGG + Intergenic
1189695741 X:43660066-43660088 AAGGGTGTGGGGCAGGAGGAAGG - Intronic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190525840 X:51328836-51328858 ATTAGGAAGGGGCAGGCAGATGG - Intergenic
1190543637 X:51502826-51502848 ATTAGGAAGGGGCAGGCAGATGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190596095 X:52053641-52053663 ATGAGCAGGGGGCAAGAAGAAGG - Intronic
1190612729 X:52200432-52200454 ATGAGCAGGGGGCAAGAAGAAGG + Intronic
1190719997 X:53139843-53139865 AGGAGGAGGAGGCAGGAGGAAGG + Intergenic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191821312 X:65311994-65312016 GGGAGTAGGGGGCAGGGGGAGGG + Intergenic
1192161409 X:68790864-68790886 AGGAGAAAGGGAGAGGAGGATGG - Intergenic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192302441 X:69919209-69919231 ATGACTAAGGGGGAAGAGGGTGG + Intronic
1192588814 X:72342557-72342579 ATGATCAAGGGGTAGAAGGAAGG - Intronic
1192806801 X:74517810-74517832 ATCAGTAGGTGGCAGGAGGAGGG - Intronic
1192847990 X:74925480-74925502 AGGAGGAAGGGGGAGGAGGGGGG - Intronic
1194646733 X:96466868-96466890 AGGAGGATGAGGCAGGAGGATGG - Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195480222 X:105336505-105336527 ATGACTAAGGAGCAGAACGAGGG - Intronic
1195676895 X:107513427-107513449 AATGGCAAGGGGCAGGAGGATGG - Intergenic
1196009242 X:110869411-110869433 ATTAGCCAGGGGCTGGAGGAGGG + Intergenic
1196316909 X:114237818-114237840 TGGGGTAAGGGGCAGGGGGAGGG - Intergenic
1196404861 X:115350485-115350507 ATGAGAAAGAGAGAGGAGGAAGG + Intergenic
1198301571 X:135338898-135338920 AAGAGAAGGGGGCATGAGGAGGG - Intronic
1198437405 X:136630560-136630582 CTGAGTGAGGGGCAGAAGGTGGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199491506 X:148405313-148405335 ATGAGTAAGGTGCAGAGGAAGGG - Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic