ID: 1145059571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:19724282-19724304 |
| Sequence | CAGGCAGTCCTAGGAGAGTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145059571_1145059579 | 11 | Left | 1145059571 | 17:19724282-19724304 | CCTGACTCTCCTAGGACTGCCTG | No data | ||
| Right | 1145059579 | 17:19724316-19724338 | CTACTGAGCCTGGCTACTGTTGG | No data | ||||
| 1145059571_1145059578 | 1 | Left | 1145059571 | 17:19724282-19724304 | CCTGACTCTCCTAGGACTGCCTG | No data | ||
| Right | 1145059578 | 17:19724306-19724328 | TATGGGTGGGCTACTGAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145059571 | Original CRISPR | CAGGCAGTCCTAGGAGAGTC AGG (reversed) | Intergenic | ||