ID: 1145059574

View in Genome Browser
Species Human (GRCh38)
Location 17:19724291-19724313
Sequence CACCCATATCAGGCAGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059574_1145059578 -8 Left 1145059574 17:19724291-19724313 CCTAGGACTGCCTGATATGGGTG No data
Right 1145059578 17:19724306-19724328 TATGGGTGGGCTACTGAGCCTGG No data
1145059574_1145059581 26 Left 1145059574 17:19724291-19724313 CCTAGGACTGCCTGATATGGGTG No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data
1145059574_1145059579 2 Left 1145059574 17:19724291-19724313 CCTAGGACTGCCTGATATGGGTG No data
Right 1145059579 17:19724316-19724338 CTACTGAGCCTGGCTACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059574 Original CRISPR CACCCATATCAGGCAGTCCT AGG (reversed) Intergenic