ID: 1145059577

View in Genome Browser
Species Human (GRCh38)
Location 17:19724301-19724323
Sequence CTCAGTAGCCCACCCATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059577_1145059583 29 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059583 17:19724353-19724375 GTCCCTGAGGTTACCCTTCCAGG No data
1145059577_1145059581 16 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data
1145059577_1145059579 -8 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059579 17:19724316-19724338 CTACTGAGCCTGGCTACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059577 Original CRISPR CTCAGTAGCCCACCCATATC AGG (reversed) Intergenic
No off target data available for this crispr