ID: 1145059577 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:19724301-19724323 |
| Sequence | CTCAGTAGCCCACCCATATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145059577_1145059583 | 29 | Left | 1145059577 | 17:19724301-19724323 | CCTGATATGGGTGGGCTACTGAG | No data | ||
| Right | 1145059583 | 17:19724353-19724375 | GTCCCTGAGGTTACCCTTCCAGG | No data | ||||
| 1145059577_1145059581 | 16 | Left | 1145059577 | 17:19724301-19724323 | CCTGATATGGGTGGGCTACTGAG | No data | ||
| Right | 1145059581 | 17:19724340-19724362 | TCTACACCTATTTGTCCCTGAGG | No data | ||||
| 1145059577_1145059579 | -8 | Left | 1145059577 | 17:19724301-19724323 | CCTGATATGGGTGGGCTACTGAG | No data | ||
| Right | 1145059579 | 17:19724316-19724338 | CTACTGAGCCTGGCTACTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145059577 | Original CRISPR | CTCAGTAGCCCACCCATATC AGG (reversed) | Intergenic | ||