ID: 1145059579

View in Genome Browser
Species Human (GRCh38)
Location 17:19724316-19724338
Sequence CTACTGAGCCTGGCTACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059574_1145059579 2 Left 1145059574 17:19724291-19724313 CCTAGGACTGCCTGATATGGGTG No data
Right 1145059579 17:19724316-19724338 CTACTGAGCCTGGCTACTGTTGG No data
1145059577_1145059579 -8 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059579 17:19724316-19724338 CTACTGAGCCTGGCTACTGTTGG No data
1145059571_1145059579 11 Left 1145059571 17:19724282-19724304 CCTGACTCTCCTAGGACTGCCTG No data
Right 1145059579 17:19724316-19724338 CTACTGAGCCTGGCTACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059579 Original CRISPR CTACTGAGCCTGGCTACTGT TGG Intergenic
No off target data available for this crispr