ID: 1145059579 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:19724316-19724338 |
Sequence | CTACTGAGCCTGGCTACTGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145059574_1145059579 | 2 | Left | 1145059574 | 17:19724291-19724313 | CCTAGGACTGCCTGATATGGGTG | No data | ||
Right | 1145059579 | 17:19724316-19724338 | CTACTGAGCCTGGCTACTGTTGG | No data | ||||
1145059571_1145059579 | 11 | Left | 1145059571 | 17:19724282-19724304 | CCTGACTCTCCTAGGACTGCCTG | No data | ||
Right | 1145059579 | 17:19724316-19724338 | CTACTGAGCCTGGCTACTGTTGG | No data | ||||
1145059577_1145059579 | -8 | Left | 1145059577 | 17:19724301-19724323 | CCTGATATGGGTGGGCTACTGAG | No data | ||
Right | 1145059579 | 17:19724316-19724338 | CTACTGAGCCTGGCTACTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145059579 | Original CRISPR | CTACTGAGCCTGGCTACTGT TGG | Intergenic | ||