ID: 1145059580

View in Genome Browser
Species Human (GRCh38)
Location 17:19724324-19724346
Sequence GTGTAGAGCCAACAGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059580_1145059583 6 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059583 17:19724353-19724375 GTCCCTGAGGTTACCCTTCCAGG No data
1145059580_1145059588 17 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059588 17:19724364-19724386 TACCCTTCCAGGCACTGGCAGGG No data
1145059580_1145059592 25 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059592 17:19724372-19724394 CAGGCACTGGCAGGGCTGTCAGG No data
1145059580_1145059581 -7 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data
1145059580_1145059586 12 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059586 17:19724359-19724381 GAGGTTACCCTTCCAGGCACTGG No data
1145059580_1145059587 16 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059587 17:19724363-19724385 TTACCCTTCCAGGCACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059580 Original CRISPR GTGTAGAGCCAACAGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr