ID: 1145059581

View in Genome Browser
Species Human (GRCh38)
Location 17:19724340-19724362
Sequence TCTACACCTATTTGTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059577_1145059581 16 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data
1145059574_1145059581 26 Left 1145059574 17:19724291-19724313 CCTAGGACTGCCTGATATGGGTG No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data
1145059580_1145059581 -7 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059581 17:19724340-19724362 TCTACACCTATTTGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059581 Original CRISPR TCTACACCTATTTGTCCCTG AGG Intergenic
No off target data available for this crispr