ID: 1145059581 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:19724340-19724362 |
| Sequence | TCTACACCTATTTGTCCCTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145059574_1145059581 | 26 | Left | 1145059574 | 17:19724291-19724313 | CCTAGGACTGCCTGATATGGGTG | No data | ||
| Right | 1145059581 | 17:19724340-19724362 | TCTACACCTATTTGTCCCTGAGG | No data | ||||
| 1145059580_1145059581 | -7 | Left | 1145059580 | 17:19724324-19724346 | CCTGGCTACTGTTGGCTCTACAC | No data | ||
| Right | 1145059581 | 17:19724340-19724362 | TCTACACCTATTTGTCCCTGAGG | No data | ||||
| 1145059577_1145059581 | 16 | Left | 1145059577 | 17:19724301-19724323 | CCTGATATGGGTGGGCTACTGAG | No data | ||
| Right | 1145059581 | 17:19724340-19724362 | TCTACACCTATTTGTCCCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145059581 | Original CRISPR | TCTACACCTATTTGTCCCTG AGG | Intergenic | ||