ID: 1145059583

View in Genome Browser
Species Human (GRCh38)
Location 17:19724353-19724375
Sequence GTCCCTGAGGTTACCCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059577_1145059583 29 Left 1145059577 17:19724301-19724323 CCTGATATGGGTGGGCTACTGAG No data
Right 1145059583 17:19724353-19724375 GTCCCTGAGGTTACCCTTCCAGG No data
1145059580_1145059583 6 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059583 17:19724353-19724375 GTCCCTGAGGTTACCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059583 Original CRISPR GTCCCTGAGGTTACCCTTCC AGG Intergenic