ID: 1145059586

View in Genome Browser
Species Human (GRCh38)
Location 17:19724359-19724381
Sequence GAGGTTACCCTTCCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059582_1145059586 -10 Left 1145059582 17:19724346-19724368 CCTATTTGTCCCTGAGGTTACCC No data
Right 1145059586 17:19724359-19724381 GAGGTTACCCTTCCAGGCACTGG No data
1145059580_1145059586 12 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059586 17:19724359-19724381 GAGGTTACCCTTCCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059586 Original CRISPR GAGGTTACCCTTCCAGGCAC TGG Intergenic