ID: 1145059587

View in Genome Browser
Species Human (GRCh38)
Location 17:19724363-19724385
Sequence TTACCCTTCCAGGCACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059580_1145059587 16 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059587 17:19724363-19724385 TTACCCTTCCAGGCACTGGCAGG No data
1145059582_1145059587 -6 Left 1145059582 17:19724346-19724368 CCTATTTGTCCCTGAGGTTACCC No data
Right 1145059587 17:19724363-19724385 TTACCCTTCCAGGCACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059587 Original CRISPR TTACCCTTCCAGGCACTGGC AGG Intergenic