ID: 1145059588

View in Genome Browser
Species Human (GRCh38)
Location 17:19724364-19724386
Sequence TACCCTTCCAGGCACTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059580_1145059588 17 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059588 17:19724364-19724386 TACCCTTCCAGGCACTGGCAGGG No data
1145059582_1145059588 -5 Left 1145059582 17:19724346-19724368 CCTATTTGTCCCTGAGGTTACCC No data
Right 1145059588 17:19724364-19724386 TACCCTTCCAGGCACTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059588 Original CRISPR TACCCTTCCAGGCACTGGCA GGG Intergenic