ID: 1145059592

View in Genome Browser
Species Human (GRCh38)
Location 17:19724372-19724394
Sequence CAGGCACTGGCAGGGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059584_1145059592 -6 Left 1145059584 17:19724355-19724377 CCCTGAGGTTACCCTTCCAGGCA No data
Right 1145059592 17:19724372-19724394 CAGGCACTGGCAGGGCTGTCAGG No data
1145059580_1145059592 25 Left 1145059580 17:19724324-19724346 CCTGGCTACTGTTGGCTCTACAC No data
Right 1145059592 17:19724372-19724394 CAGGCACTGGCAGGGCTGTCAGG No data
1145059585_1145059592 -7 Left 1145059585 17:19724356-19724378 CCTGAGGTTACCCTTCCAGGCAC No data
Right 1145059592 17:19724372-19724394 CAGGCACTGGCAGGGCTGTCAGG No data
1145059582_1145059592 3 Left 1145059582 17:19724346-19724368 CCTATTTGTCCCTGAGGTTACCC No data
Right 1145059592 17:19724372-19724394 CAGGCACTGGCAGGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059592 Original CRISPR CAGGCACTGGCAGGGCTGTC AGG Intergenic