ID: 1145059696

View in Genome Browser
Species Human (GRCh38)
Location 17:19724813-19724835
Sequence GCTCGCCGCCCCTGAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145059696_1145059705 11 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059705 17:19724847-19724869 CTCCCCGTGGACCCTGCCCTCGG No data
1145059696_1145059714 23 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059714 17:19724859-19724881 CCTGCCCTCGGGGGCTGCACAGG No data
1145059696_1145059708 13 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059708 17:19724849-19724871 CCCCGTGGACCCTGCCCTCGGGG No data
1145059696_1145059700 -2 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059700 17:19724834-19724856 GCGCGCCCACCCGCTCCCCGTGG No data
1145059696_1145059706 12 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059706 17:19724848-19724870 TCCCCGTGGACCCTGCCCTCGGG No data
1145059696_1145059710 14 Left 1145059696 17:19724813-19724835 CCAGCCCCTCAGGGGCGGCGAGC No data
Right 1145059710 17:19724850-19724872 CCCGTGGACCCTGCCCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145059696 Original CRISPR GCTCGCCGCCCCTGAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr