ID: 1145062008

View in Genome Browser
Species Human (GRCh38)
Location 17:19739464-19739486
Sequence GGCCCCAGGACCCTGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 0, 2: 11, 3: 89, 4: 674}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145061999_1145062008 17 Left 1145061999 17:19739424-19739446 CCAGAGAACAGTGAAGCTGCAGT 0: 1
1: 0
2: 0
3: 28
4: 219
Right 1145062008 17:19739464-19739486 GGCCCCAGGACCCTGGCAGAGGG 0: 1
1: 0
2: 11
3: 89
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145062008 Original CRISPR GGCCCCAGGACCCTGGCAGA GGG Intronic
900018392 1:170385-170407 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
900048648 1:528980-529002 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
900070877 1:770804-770826 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
900186884 1:1336890-1336912 CGGCCCAGGACCCTGGCCGACGG + Intronic
900230124 1:1552474-1552496 GGCACCAAGACCCTGGTAGAAGG - Intronic
900299624 1:1970202-1970224 GGCCCCAAGGCCGTGGCAGCAGG + Intronic
900362263 1:2294785-2294807 GGTGCCAGGAGACTGGCAGACGG - Intronic
900414462 1:2528602-2528624 GCCCCCTGGACCCCGGAAGAAGG - Intergenic
900636764 1:3669748-3669770 GGAAGCAGGACCCAGGCAGAAGG - Intronic
900647807 1:3716874-3716896 GGGTCCAGGGCCTTGGCAGAGGG + Intronic
900710380 1:4109600-4109622 GGCCCGGGGATCCTGGCAGTGGG + Intergenic
900759753 1:4462897-4462919 GGCCTGGGCACCCTGGCAGAGGG + Intergenic
900815517 1:4840740-4840762 GGCCTCACAATCCTGGCAGAAGG + Intergenic
900926806 1:5711159-5711181 GGCCCCAGGACTTAGGGAGAAGG + Intergenic
900937112 1:5773443-5773465 AGGCCCAGGACCCTTGCAGTGGG + Intergenic
901031125 1:6307601-6307623 AGAACCAAGACCCTGGCAGAGGG + Intronic
901305226 1:8227902-8227924 GGCCTCACGATCATGGCAGAAGG - Intergenic
901458528 1:9377597-9377619 GGTCCCAGGACCCTGGACTAGGG + Intergenic
901663615 1:10814126-10814148 GTCCTCAGGAACCTGGGAGAGGG + Intergenic
901781769 1:11598989-11599011 ACTCCCAGGACCCTGGGAGAGGG + Intergenic
901880443 1:12190897-12190919 GAGCCCAGGGTCCTGGCAGAAGG + Intronic
902102423 1:14002498-14002520 GGCCTCAGAATCATGGCAGAAGG - Intergenic
903815376 1:26060777-26060799 GGCCCAGGGACCCAGGGAGAAGG + Intronic
903996253 1:27307057-27307079 TTCCCAAGGGCCCTGGCAGAGGG + Exonic
904337474 1:29807465-29807487 GGCCTCAGGATCATGGCAGAGGG - Intergenic
905095160 1:35463979-35464001 GGCCTCACAACCATGGCAGAAGG - Intronic
905482961 1:38274349-38274371 GGCCTCACAACCATGGCAGAAGG + Intergenic
906278519 1:44536515-44536537 GTCCCCAGGGCCCTGGAACATGG + Intronic
907255295 1:53174220-53174242 AGCCATAGGACCTTGGCAGAAGG - Intergenic
907318463 1:53587779-53587801 GACCCCAGGACCCAGCCAGGGGG + Intronic
907674825 1:56508781-56508803 GGCACCAGGTGCCTGGGAGAGGG - Intronic
907956548 1:59233473-59233495 GGCCTCACAACCATGGCAGAAGG - Intergenic
908253105 1:62280655-62280677 GTCCCCAGGAAACTTGCAGAAGG - Intronic
908875849 1:68674794-68674816 GGCCCCATAATCATGGCAGAAGG + Intergenic
909063326 1:70904171-70904193 GGCCTCAGAATCATGGCAGAAGG - Intronic
909177847 1:72382457-72382479 GGCCTCAGAATCATGGCAGAGGG - Intergenic
910057773 1:83052022-83052044 GGCCTCAGAACCATGGCAGGAGG + Intergenic
911624303 1:100103853-100103875 GGCTACAGGACATTGGCAGAAGG - Intronic
911951078 1:104174021-104174043 GGCCTCACGATCATGGCAGAAGG + Intergenic
912438091 1:109675966-109675988 GGCCTCATAACCATGGCAGAAGG + Intronic
912440602 1:109694425-109694447 GGCCTCATAACCATGGCAGAAGG + Intronic
913112759 1:115671176-115671198 GGCCCCTGGCCCCTGGGAGATGG + Intronic
915516189 1:156413924-156413946 GGCCTCTGTGCCCTGGCAGATGG + Intronic
915592400 1:156878199-156878221 GGCCCAATGCCCCAGGCAGAGGG - Intronic
915695619 1:157738915-157738937 GGCCCCACTATCATGGCAGAAGG + Intergenic
915908986 1:159900448-159900470 GGCCCCAGGAGCCTGGCCCAGGG + Intergenic
915923331 1:159995425-159995447 GGCCTCAGAATCATGGCAGAAGG + Intergenic
916734937 1:167599171-167599193 GGCCTCAGAATCATGGCAGAGGG + Intergenic
917966569 1:180182781-180182803 AGCAGCAGGAGCCTGGCAGAGGG - Intronic
917980853 1:180268022-180268044 GGCCCCAGGTCTCTGGAGGAAGG - Intronic
918187446 1:182140932-182140954 GGCTCCAGGAATCTTGCAGAGGG + Intergenic
918541212 1:185634940-185634962 GGCCTCACGATCATGGCAGAAGG - Intergenic
919756942 1:201072098-201072120 GGCCCCAGGGCTCTGTCAGGTGG + Intronic
920399483 1:205668243-205668265 AGCCCGAGGACCCTGGAGGAGGG - Intronic
921327124 1:213997395-213997417 GGGCCCAGGACTCTGTCGGAAGG + Exonic
921529932 1:216269368-216269390 GGCCTCACGATCATGGCAGAAGG - Intronic
921792869 1:219309699-219309721 GGCCTCAGAATCATGGCAGAAGG - Intergenic
922106243 1:222516250-222516272 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
922152469 1:223017714-223017736 GGCCTCAGAATCATGGCAGAAGG + Intergenic
922176294 1:223200554-223200576 GGCCCCCGGCAGCTGGCAGAAGG + Intergenic
922336405 1:224622038-224622060 GGCCTCATGATCATGGCAGAAGG - Intronic
922667954 1:227488829-227488851 GGCCCCACAATCATGGCAGAAGG + Intergenic
922749712 1:228064729-228064751 GGCCCCAGGATCCTGAAAGTAGG - Intergenic
924348423 1:243093815-243093837 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
924382016 1:243474312-243474334 GGCCTCTGGACTTTGGCAGAAGG - Intronic
1063448405 10:6134685-6134707 GGGCCCAGGAACCTGGCAGCAGG - Intergenic
1063547560 10:6997271-6997293 AGCCCCAGGTCCCAGGCAGATGG - Intergenic
1063920896 10:10931854-10931876 GGCCTCACAACCATGGCAGAAGG + Intergenic
1064236442 10:13580537-13580559 TGCCCCAGGAGCATGACAGAAGG - Intergenic
1065681762 10:28242591-28242613 GTCTCCAGGACCCTTCCAGAGGG + Intronic
1066294638 10:34043520-34043542 ACCCCCAGGACCATGACAGATGG + Intergenic
1066457509 10:35585072-35585094 GGCCCAGGCACCCAGGCAGATGG - Intergenic
1066727937 10:38411086-38411108 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1067057157 10:43058923-43058945 TGCCCCAAGTCCCTGGCACACGG + Intergenic
1067144520 10:43684795-43684817 GGCCTCATGATCATGGCAGAAGG - Intergenic
1067567603 10:47349965-47349987 GGCCTCAGGGCCCTGGAAGTAGG - Exonic
1068617475 10:59135511-59135533 GGCCCCTGGATCCTGCCATATGG - Intergenic
1069111141 10:64447899-64447921 ACCCCCAGGTACCTGGCAGAAGG + Intergenic
1069621867 10:69842285-69842307 GGCCCCACAACCCTGGCAGAAGG - Intronic
1069804293 10:71108320-71108342 GGCCTCAGGATCATGGCAGGAGG - Intergenic
1069929695 10:71874146-71874168 GGCTCCAGAACCCAGGGAGAAGG + Intergenic
1070194072 10:74140163-74140185 CGCCCCAGGGCCCTGGCACCCGG - Intronic
1070452922 10:76579942-76579964 GGCCCCACAATCATGGCAGAAGG + Intergenic
1070456088 10:76619058-76619080 GGCCTCACGATACTGGCAGAAGG + Intergenic
1070748000 10:78946513-78946535 GGCTCCAGGACAAGGGCAGAAGG + Intergenic
1071463675 10:85921002-85921024 GGCCACAGGAGCCAGGCAGATGG - Intronic
1072914239 10:99527337-99527359 GGCCCCAGGCCCTTGGCGGGCGG + Intergenic
1073293657 10:102425492-102425514 GACCCCAAGACCTTGTCAGAAGG - Intronic
1073491345 10:103855338-103855360 GGCCCCGGGACCCCGGCAGCTGG - Exonic
1073675237 10:105639120-105639142 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1073723477 10:106202536-106202558 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1073855723 10:107671038-107671060 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1074022506 10:109598127-109598149 GGCCTCACAACCATGGCAGAAGG + Intergenic
1075089517 10:119435899-119435921 GGCCCCACAATCATGGCAGAAGG + Intronic
1075627995 10:123977172-123977194 GGCCTCACGATCGTGGCAGAAGG - Intergenic
1075686757 10:124369698-124369720 GGCCTCATGATCATGGCAGAAGG - Intergenic
1075699103 10:124457098-124457120 GGCCCTAGGAACCTGGAAGATGG - Intergenic
1075782627 10:125026905-125026927 GCCACCAGGACCCTGGAAGGTGG + Exonic
1075834589 10:125442975-125442997 GGGCCCAGCACCCTGGCTGGTGG + Intergenic
1076155539 10:128202340-128202362 GGCCTCATGATCATGGCAGAAGG + Intergenic
1076600733 10:131655349-131655371 AGCCCCGGGACCCTGGGAAAAGG - Intergenic
1076670554 10:132118508-132118530 GGCCCCGGGAAGCAGGCAGAGGG - Intronic
1076705634 10:132299918-132299940 GGACCCAGGGCGCTGGCACAGGG + Intronic
1076756588 10:132575775-132575797 CGGCCCAGGGCCCTGGCAGTGGG + Intronic
1076783948 10:132739800-132739822 GGCCCCTGGGTCCTGGCAGGGGG - Intronic
1076847341 10:133075740-133075762 GGCCACAGGACCCAGGTAGTGGG - Intronic
1076974995 11:165581-165603 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
1077082039 11:728566-728588 GGCCCCCCCACCCTGTCAGATGG + Intergenic
1077279318 11:1734955-1734977 GGCCCCAGGAGCCTGGGAAGGGG + Exonic
1077284087 11:1758245-1758267 GGCCCAGGGACCCGGGAAGAGGG - Intronic
1079181802 11:18200566-18200588 GGCCTCATGATCATGGCAGAAGG + Intronic
1079182072 11:18202514-18202536 GGCCTCATGATCATGGCAGAAGG + Intronic
1079301034 11:19278994-19279016 GGCCTCACAATCCTGGCAGAAGG - Intergenic
1080104332 11:28496192-28496214 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1080868088 11:36213187-36213209 GTTCCCAGCATCCTGGCAGATGG + Intronic
1081122791 11:39286812-39286834 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1082162493 11:48900571-48900593 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1082174893 11:49048564-49048586 AGCCCCAGGACCCCGGCAGCGGG + Intergenic
1082238930 11:49852165-49852187 AGCCCCAGGACCCCGGCAAAGGG - Intergenic
1082243212 11:49892165-49892187 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1082284215 11:50301872-50301894 GTCCCCAGGACCCTGGGAGAGGG - Intergenic
1082657711 11:55872990-55873012 AGCCCCAGGACCCCGGCAGCGGG + Intergenic
1083272542 11:61579723-61579745 GCCCCCAGGAGGCTGGCAGGAGG + Intronic
1083471020 11:62883988-62884010 GGCCTCAGGAAACTGGGAGAGGG + Intronic
1083616493 11:64028986-64029008 AGCCCCAGGACTCTGGGAGAGGG + Intronic
1084170730 11:67399707-67399729 AGCCCAGGGACCCTGGCTGAGGG - Intronic
1084171018 11:67401221-67401243 GGACCCTGGACCCTGACAGGAGG + Exonic
1084268062 11:68015032-68015054 GCCTCCAGGTCCATGGCAGAGGG + Intronic
1084383571 11:68828578-68828600 AGCCCCAGCACGCTGGGAGAAGG + Intronic
1084498286 11:69518529-69518551 GGCCTCAGGATCATGGCAGAAGG - Intergenic
1084547778 11:69822925-69822947 GGACCCAGGACCCGAGCAGTGGG + Intergenic
1084576808 11:69993872-69993894 GGCCCCAGGAGCAGGGAAGAGGG - Intergenic
1084724151 11:70929502-70929524 GGCCTCTAGAACCTGGCAGAGGG - Intronic
1085465019 11:76717214-76717236 GGCCCTAGGGTCCTGGGAGACGG + Intergenic
1086224504 11:84491384-84491406 GGCCCCACAATCATGGCAGAAGG - Intronic
1086690881 11:89787522-89787544 AGCCCCAGGACCCCGGCAGCGGG - Intergenic
1086697640 11:89863988-89864010 AGCCCCAGGACCCTGGCAGCGGG + Intergenic
1086708519 11:89980500-89980522 AGCCCCAGGACCCTGGCAGCGGG - Intergenic
1086714919 11:90052133-90052155 AGCCCCAGGACCCCGGCAGCGGG + Intergenic
1086791026 11:91038412-91038434 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1087829999 11:102808911-102808933 GGCCTCACAATCCTGGCAGAAGG - Intergenic
1089133962 11:116234720-116234742 GGGCCCAGCACCCTTGCAGTGGG - Intergenic
1089310737 11:117556633-117556655 GACCCCAGGGCCCTGGAAGTGGG + Intronic
1089400892 11:118164020-118164042 GGCCTCAGGGCCCCAGCAGATGG - Exonic
1089679679 11:120112266-120112288 GCCCCCAAGAGGCTGGCAGAGGG + Exonic
1090338543 11:125993637-125993659 TGCCTCAGGACCTTGGCACAGGG - Intronic
1090727224 11:129539050-129539072 GGCCTCAGAACCATGGCAGGAGG + Intergenic
1090928762 11:131276893-131276915 GGCCTCACAACCATGGCAGAAGG - Intergenic
1091244784 11:134082626-134082648 GGCCTCATAACCATGGCAGAAGG - Intronic
1091269673 11:134298704-134298726 GGCCTCAGAATCATGGCAGAAGG - Intronic
1091338868 11:134795053-134795075 GGGCCCAGGAGGCTGACAGAGGG + Intergenic
1091435410 12:468879-468901 GGCCACACGACCCAGGAAGAGGG + Intronic
1091477936 12:795571-795593 GGCCTCAGAATCGTGGCAGAAGG - Intronic
1092333471 12:7606870-7606892 GCCCCCAGGCCCCAGGCACATGG + Intergenic
1092872534 12:12818746-12818768 GGCCCCAGAATCATGGCAGGAGG + Intronic
1093483169 12:19625965-19625987 GGCCTCAGAACCATGGCAGGAGG - Intronic
1095213833 12:39525998-39526020 GGCCTCACAACCATGGCAGAAGG + Intergenic
1095633232 12:44402076-44402098 GGCCTCACAACCATGGCAGAAGG + Intergenic
1096034195 12:48450003-48450025 GGCCTCAGGATCATGGCAGAGGG - Intergenic
1096164654 12:49411826-49411848 GGCCCCAGCAGAATGGCAGAAGG - Intronic
1096693642 12:53335665-53335687 GTCCCAAGGAGCCAGGCAGATGG + Exonic
1097269387 12:57765047-57765069 GGCCCCAGGGCCCAGGCACAAGG + Exonic
1097320645 12:58222392-58222414 GCCCCCAGAACCTTGGCAGTTGG - Intergenic
1097570374 12:61325148-61325170 GGCCTCAGGATCATGGCAGGAGG + Intergenic
1098109001 12:67102039-67102061 GGCCTCACGATCATGGCAGAAGG + Intergenic
1098461253 12:70735336-70735358 GGCCCCACAATCATGGCAGAAGG + Intronic
1099433712 12:82619228-82619250 AGCCTCACAACCCTGGCAGAAGG - Intergenic
1099490643 12:83284093-83284115 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1099722439 12:86381938-86381960 GGCCTCACAACCATGGCAGAAGG - Intronic
1099757367 12:86870334-86870356 GGCCTCACGATCATGGCAGAAGG + Intergenic
1100067354 12:90665143-90665165 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1100337399 12:93644347-93644369 GGCCTCACGATCATGGCAGAAGG + Intergenic
1100349291 12:93763767-93763789 ATCCCCAAGCCCCTGGCAGAAGG + Intronic
1100609674 12:96180997-96181019 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1100870781 12:98907921-98907943 GGCCTCACAATCCTGGCAGAAGG - Intronic
1101076014 12:101130574-101130596 GGCCTCATGATCATGGCAGAAGG + Intergenic
1101215336 12:102575935-102575957 GGCCTCAGAATCATGGCAGAGGG - Intergenic
1101812232 12:108117631-108117653 GGACCCCGGACCCTGCCATATGG + Intergenic
1102553952 12:113713591-113713613 GGCCTCATGATCATGGCAGAAGG + Intergenic
1103412152 12:120720069-120720091 GGCCACAAGATCCTGGCACACGG + Exonic
1103510106 12:121467796-121467818 GTCCCCAGGTCCCTTGCAGCAGG + Intronic
1103880182 12:124159982-124160004 GGCCCCAGGCCCCAGGCTGGAGG - Intronic
1104113481 12:125726065-125726087 GGCCTCACGATCATGGCAGAAGG + Intergenic
1104188026 12:126451040-126451062 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1104404741 12:128508155-128508177 GGCCTCACGATCATGGCAGAAGG + Intronic
1104757640 12:131279075-131279097 CGCTCCAGGACCGGGGCAGAGGG + Intergenic
1105699100 13:22922467-22922489 GGCCCAAGGACCCCTGCACATGG + Intergenic
1106678475 13:31985693-31985715 GGCCTCAGAACCATGGCAGGAGG - Intergenic
1107011148 13:35672906-35672928 TGCCCCAGATCCCTGCCAGATGG - Intronic
1108419680 13:50235194-50235216 GGCCTCAGAATCATGGCAGAAGG - Intronic
1109721244 13:66278519-66278541 GGCCTCATGATCATGGCAGAAGG + Intergenic
1109906084 13:68844383-68844405 GGCCTCATGATCATGGCAGAAGG - Intergenic
1110250802 13:73378217-73378239 GGCCTCATGATCATGGCAGAAGG + Intergenic
1110313055 13:74073111-74073133 GGCCTCACGATCATGGCAGAAGG - Intronic
1110532083 13:76609606-76609628 GGCCTCACAACCATGGCAGAAGG + Intergenic
1110806255 13:79757569-79757591 GGCCCCACAATCATGGCAGAAGG + Intergenic
1111313113 13:86516382-86516404 GGCCTCAGAATCCTGGCTGAAGG + Intergenic
1111943254 13:94636192-94636214 GGCCTCACGATCATGGCAGAAGG + Intergenic
1111946237 13:94668631-94668653 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1112007586 13:95267386-95267408 GGCCTCACAATCCTGGCAGAAGG - Intronic
1113153510 13:107290566-107290588 GGCCTCACGATCATGGCAGAAGG - Intronic
1113612633 13:111658291-111658313 GGCCACAGGGCCCAGGCAGCAGG + Intronic
1114627045 14:24136603-24136625 GGCCCCGGGACCCTCCCTGAGGG - Intronic
1115194223 14:30778513-30778535 GGGACCAGGGCCCAGGCAGAAGG - Intergenic
1116356561 14:43937894-43937916 GGCCTCACAACCATGGCAGAAGG + Intergenic
1116618060 14:47163561-47163583 GGCCTCAGGATCATGGTAGAAGG - Intronic
1118011406 14:61614429-61614451 GCCCCCATGACCCTGCCTGAGGG + Intronic
1118051721 14:62036606-62036628 GGCCTCATGATCATGGCAGAAGG + Intronic
1118590943 14:67400522-67400544 TGCCCCAGGACCCCTGCAGTTGG - Intronic
1118760303 14:68876961-68876983 GGCCAAAGGACCCTGGAAGAAGG + Intronic
1118900785 14:69983647-69983669 GGGCTCAGGAACCTGGCAGAGGG - Intronic
1119652048 14:76390978-76391000 GGCCCCAGGACCTTGCGAGGAGG + Intronic
1121010610 14:90518028-90518050 GGCCCCAGGACACTTGCTGGGGG - Intergenic
1121507881 14:94490390-94490412 GGCCCCAGGCTCCGGGCAGGAGG - Intronic
1121637345 14:95462594-95462616 TGCCCCAGGACACTGCCAGGCGG + Intronic
1121862859 14:97336001-97336023 GGACCCAGGACCAGGACAGAAGG + Intergenic
1122586063 14:102807341-102807363 GGCCCCAGGCCCCTGGAGAAAGG - Intronic
1122637711 14:103138219-103138241 GGGTCCAGGAGCCGGGCAGAGGG - Intergenic
1122843359 14:104477315-104477337 GAGCCCAGGACCCTGGCCCAGGG - Intronic
1122871774 14:104642079-104642101 GGTCCCAGGGCCAGGGCAGACGG - Intergenic
1122974197 14:105164344-105164366 GGCCCCAGGGCCATGGCAGGAGG + Intronic
1123032654 14:105459088-105459110 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123032823 14:105459560-105459582 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123032971 14:105459973-105459995 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123032991 14:105460032-105460054 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123033011 14:105460091-105460113 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123033031 14:105460150-105460172 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123033052 14:105460209-105460231 GGCCCCTGGTCCCTGGCACCTGG + Intronic
1123106836 14:105845738-105845760 GGGCAGAGGACCCTGGCAGCAGG + Intergenic
1124171483 15:27377485-27377507 GGCCTCACAATCCTGGCAGACGG + Intronic
1124225115 15:27887134-27887156 GGCCTCACGATCATGGCAGAAGG - Intronic
1124869939 15:33530607-33530629 GGCCACAGGACCCTGTTATACGG + Exonic
1125231631 15:37463342-37463364 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1125731180 15:41893590-41893612 GACCCCAGGCCCCTGGTAGAGGG - Intronic
1126942945 15:53785733-53785755 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1126955509 15:53929103-53929125 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1128058706 15:64719682-64719704 GGCCCCAGGACCACAGCTGATGG + Intergenic
1128709995 15:69864578-69864600 GGCCCCACAATCATGGCAGAAGG + Intergenic
1129465846 15:75723814-75723836 GTCCCCAGGACCCTGGGTCAGGG - Intergenic
1129787703 15:78320445-78320467 GAGCCAGGGACCCTGGCAGATGG - Intergenic
1129880999 15:79005920-79005942 CACCCCAGGATCCTGGCAGGTGG + Intronic
1129881668 15:79010786-79010808 AGCCCCAGGAGCCTGGCAGGTGG + Intronic
1129903927 15:79172763-79172785 GTCCCCAGGAGCCCAGCAGAGGG - Intergenic
1130403611 15:83579362-83579384 GACCCCAGGATCCAGGCTGAGGG - Intronic
1130524263 15:84690318-84690340 GGCCCCACAATCATGGCAGAAGG - Intronic
1130910771 15:88269513-88269535 TGCCCGAGGCTCCTGGCAGAAGG + Intergenic
1131079581 15:89523417-89523439 AGCCCCAGGACAGTGGAAGAAGG + Intergenic
1131133138 15:89912760-89912782 GGTCCCAGGCCCCTGGCAGCCGG + Exonic
1131477472 15:92752436-92752458 GGCCTCACAACCATGGCAGAAGG - Intronic
1131964845 15:97830866-97830888 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG + Intergenic
1132490657 16:228917-228939 GGCTCCAGGTCGCTGGCAGCCGG - Intronic
1132572139 16:648837-648859 GGCCGCAGGACACTGGGCGAAGG + Intronic
1132670624 16:1100872-1100894 GGCCCCAAGACTCTGGCGAAAGG + Intergenic
1133027823 16:2996392-2996414 GGGCCCAGGGCCCTGGGAGGGGG - Intergenic
1133040321 16:3057129-3057151 GCCCACCGGACCCTGGTAGAAGG - Exonic
1133253886 16:4504254-4504276 GGCCTCAGCACGCTTGCAGAGGG + Intronic
1133881449 16:9786380-9786402 GGCCCCAGCACCGTGGGAGCAGG - Intronic
1134020236 16:10916321-10916343 GGCCCCAGGACGCTAGCTGATGG + Intronic
1135100249 16:19598988-19599010 GACCCCAGAACCCTGGCATTAGG - Intronic
1135617102 16:23920940-23920962 GGCCTCACGATCATGGCAGAAGG + Intronic
1135656347 16:24253697-24253719 GTGCCCAGGAGCCTAGCAGAAGG - Intergenic
1136220174 16:28823426-28823448 GGCCACAGGCCCCAGGCAGGGGG - Exonic
1136505192 16:30698581-30698603 GGCCCCGGGGCCCCGGCTGAGGG - Intronic
1137596992 16:49730736-49730758 AGCCCCAGGACTCTGACAGGTGG - Intronic
1138266960 16:55666457-55666479 TGCCCAAGGACTCTTGCAGAAGG - Intronic
1138355756 16:56379190-56379212 GGCCTCACGACCATGGCAGAAGG + Intronic
1138442052 16:57041030-57041052 GGCACCAGGATCATGACAGAAGG - Intronic
1138548298 16:57732863-57732885 GGCCCCACAATCATGGCAGAAGG + Intergenic
1139122878 16:64042300-64042322 GGCCTCACAACCATGGCAGAAGG + Intergenic
1139350465 16:66331829-66331851 GGCCTCATGATCATGGCAGAAGG - Intergenic
1140188017 16:72791667-72791689 CAGCCCAGGACCCTGGCAGAGGG - Intronic
1141078755 16:81032624-81032646 GGACCCAGGACCCGAGCAGCTGG + Exonic
1141439109 16:84017872-84017894 GGTCCCATGACCCTGGCAGTGGG + Intronic
1141677660 16:85526007-85526029 GGTCCCAGGACCCTTGCTGGAGG - Intergenic
1141855918 16:86681523-86681545 GGGCCCAGGAGCTGGGCAGAGGG + Intergenic
1142445268 16:90132078-90132100 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1142462241 17:103388-103410 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
1142714065 17:1738397-1738419 GGCTCCACGACCCTGAGAGAAGG + Exonic
1143150892 17:4807214-4807236 GGCCCCCTCACCCTGGCAGACGG - Exonic
1144773195 17:17770903-17770925 GGCCAGAGGACACGGGCAGAGGG - Intronic
1144836477 17:18159050-18159072 GGCCCCAGGGGCCTGGGAGGGGG - Intronic
1145062008 17:19739464-19739486 GGCCCCAGGACCCTGGCAGAGGG + Intronic
1146305926 17:31729784-31729806 TGCCCCAGATCACTGGCAGAAGG - Intergenic
1146566671 17:33919149-33919171 GAACCCAGGGTCCTGGCAGAAGG - Intronic
1147533603 17:41302841-41302863 AGCACCAGCACCATGGCAGACGG - Exonic
1147951926 17:44112291-44112313 AGCCCCAGGACCCAGGGAGCAGG - Intronic
1148569815 17:48659365-48659387 GGCCTCACGATCATGGCAGAAGG - Intergenic
1148690654 17:49525019-49525041 GCCGCCAGGAGCCTGGCACAGGG + Intergenic
1148691446 17:49529152-49529174 GGCCCCAGGGCCCAGGCTGCAGG - Intergenic
1148773194 17:50078764-50078786 GAGACCAGGGCCCTGGCAGAGGG - Intronic
1149449299 17:56737585-56737607 AGCCCCAGGCCCCTGGCAGCTGG + Intergenic
1149495217 17:57113155-57113177 TGCCCCAGGAGTTTGGCAGAGGG + Intronic
1149659725 17:58327934-58327956 GGCCCCAGAACCCGGGCCGGGGG + Exonic
1150941597 17:69699308-69699330 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1151101172 17:71556998-71557020 GGCCTCACGATCATGGCAGAAGG + Intergenic
1151131758 17:71904453-71904475 GGCCTCACAACCATGGCAGAAGG + Intergenic
1151235388 17:72716173-72716195 GGGCAGAGGCCCCTGGCAGATGG + Intronic
1151717837 17:75840465-75840487 GGGCCCAGGAGCGAGGCAGAGGG - Intronic
1151802588 17:76386611-76386633 GGCCCCAGGACTAAGGGAGAAGG - Intronic
1151963039 17:77417397-77417419 GGCCGATGGACCCTGGCAGAGGG + Intronic
1152103697 17:78316812-78316834 AGCCCCATGACCCAGGCACAGGG - Intergenic
1152220565 17:79062755-79062777 GGCCTCACAACCATGGCAGAAGG + Intergenic
1152312243 17:79558453-79558475 GGCCCCAGGGTGCTGGCGGATGG + Intergenic
1152528022 17:80900674-80900696 GCCACCAGGCCCTTGGCAGACGG - Intronic
1152888095 17:82864547-82864569 GTCCCCAGCACCTTGACAGAGGG + Intronic
1152926018 17:83088120-83088142 GGCCCCAGGACCTTGGGATTTGG + Intronic
1153131886 18:1863307-1863329 GGCCCCAGGGCCCTGGGATGTGG - Intergenic
1154092562 18:11378967-11378989 GCCCCCAGGAGCCAGACAGAAGG + Intergenic
1157198926 18:45642620-45642642 GTCCCCAGGAGCCAGGCAGCTGG - Intronic
1157576825 18:48749238-48749260 GGCCTCGGCACCCTGGCTGATGG - Intronic
1157593702 18:48851195-48851217 GGCCCCAGGAGCCTGCCTGCGGG + Intronic
1158483894 18:57847444-57847466 GGCCTCAAGATCATGGCAGAAGG + Intergenic
1158547150 18:58405987-58406009 GACCCCAGAAGCTTGGCAGATGG - Intergenic
1160179074 18:76618859-76618881 GTTCTCACGACCCTGGCAGAGGG - Intergenic
1160510037 18:79448277-79448299 GGCCCCAGCACCCTTCCTGATGG - Intronic
1160537072 18:79600381-79600403 GGCCCTGGGCCACTGGCAGAGGG + Intergenic
1160651947 19:235764-235786 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
1160690948 19:460551-460573 GGCCCCAGGACCCTGGCGTCGGG + Exonic
1161043665 19:2123191-2123213 CGCCACAGGGCACTGGCAGAGGG + Intronic
1161089256 19:2352011-2352033 GGCCGCAGGGCCCTGGACGAGGG + Intronic
1161105749 19:2443228-2443250 AGCCCCAGGCCCCGGGCAGGCGG + Intronic
1161121407 19:2528873-2528895 TGCCACAGGTCCCTGGAAGAGGG - Intronic
1161134449 19:2611429-2611451 CGTCCCAGGACCGTGGCAGGAGG + Intronic
1161496714 19:4590622-4590644 TGCCCCAGGACCTTTGCACAGGG - Intergenic
1161651243 19:5486644-5486666 CCCTCCAGGACCCTGGCTGATGG - Intergenic
1162070885 19:8151533-8151555 GGCCCGTGGACCCTGTGAGAAGG + Intronic
1162775136 19:12974903-12974925 GGAACCAGGGCCCTGGCAGATGG + Intergenic
1162848341 19:13411508-13411530 GGCCTCACAACCATGGCAGAAGG - Intronic
1163284626 19:16338622-16338644 AGCTCCCGGACCCTGCCAGAGGG - Intergenic
1163669167 19:18617508-18617530 GGCCACAGAACCCAGGGAGATGG - Intronic
1163689385 19:18730445-18730467 GGCCCCAGTACACTGGGAGAAGG - Intronic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1163734704 19:18972550-18972572 GGCCCCAAGACCCACGCTGAAGG - Intergenic
1164408173 19:27973244-27973266 GGCCCCAGCAGCTAGGCAGATGG + Intergenic
1164599258 19:29549801-29549823 GGCCCCAGGAAGCTCGGAGACGG + Intronic
1164849889 19:31472731-31472753 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1164930160 19:32169110-32169132 GGCCTCAAGACCCTTCCAGAAGG - Intergenic
1165882236 19:39052487-39052509 GGCCCCAGGACCACGCCACAGGG + Intergenic
1165888520 19:39096755-39096777 GGCCTCAGAATCATGGCAGAAGG + Intronic
1165895468 19:39138695-39138717 CGCCCCTGGACCCTGGCGGAGGG + Intronic
925167681 2:1728325-1728347 GGCCCAGGGACCCTGCCAGCAGG - Intronic
925172378 2:1758195-1758217 GACCCCAGAAGCCTGGCAGGTGG + Intergenic
925234185 2:2263632-2263654 CGCCCCAGGATCCTGGCAGGTGG + Intronic
925799578 2:7584779-7584801 GGCCTCACGATCCTGGCAGAAGG - Intergenic
925825727 2:7846803-7846825 GGCCCCATGATCCCTGCAGAAGG + Intergenic
926030019 2:9578279-9578301 TGGCCCGGGACCCTGGCTGATGG + Intergenic
926245261 2:11118420-11118442 GGCCTCAGGATCATGGCAGAAGG + Intergenic
926496482 2:13594778-13594800 GGCCTCACAACCATGGCAGAAGG + Intergenic
926776252 2:16425970-16425992 AGCCCCAGGGCCCTGGGAGCAGG - Intergenic
927091769 2:19717850-19717872 GGCCCCAGGCCCCAAGGAGAAGG + Intergenic
927096694 2:19752661-19752683 GGGACCAGGACGCTGGCACAGGG - Intergenic
927576414 2:24205391-24205413 GGGCCCAGGGCAGTGGCAGATGG - Intronic
927910497 2:26894704-26894726 GGCCCAAGGAGCATGGCTGAGGG - Intronic
928300035 2:30116871-30116893 GGCCCCAGGACTCTGGCTTCAGG - Intergenic
929791186 2:45024300-45024322 GGCTCCAGGACCATGCCAGGAGG - Intergenic
930497898 2:52172460-52172482 GGCCTCACAACCATGGCAGAAGG + Intergenic
930960008 2:57250519-57250541 TGCCTCAGAACCATGGCAGAAGG + Intergenic
931079323 2:58751910-58751932 GGCCTCATGATCATGGCAGAAGG - Intergenic
931089376 2:58869140-58869162 GGCCCCACGATCATGGCGGAAGG - Intergenic
931668299 2:64625553-64625575 GGCCCCAGGACCCTTTGGGATGG - Intergenic
931777038 2:65549716-65549738 GAACACAGGACCCTGGCAGGAGG + Intergenic
932019952 2:68074268-68074290 GGCCCCACAATCATGGCAGATGG - Intronic
932571949 2:72942828-72942850 GGCACCAGGCCTCTGGCAGGGGG + Exonic
932756672 2:74414551-74414573 AGGGCCAGGATCCTGGCAGATGG - Exonic
933064032 2:77772124-77772146 GGCCCCACAATCATGGCAGAAGG + Intergenic
933128057 2:78635763-78635785 GGCCTCACAACCATGGCAGAAGG + Intergenic
934144025 2:89074348-89074370 GGCCTCACGGCCATGGCAGAAGG - Intergenic
934588583 2:95526907-95526929 AGCCCCAGGACCCCGGCAGCCGG - Intergenic
934603624 2:95678103-95678125 GGCCAGAGGACCCTGGCTGCTGG + Intergenic
934924403 2:98371902-98371924 GGGCCCAAGACCTTGGGAGAAGG + Intronic
935726004 2:106024564-106024586 GGCCCCAAGGCCCTGCCTGAGGG - Intergenic
936350406 2:111707958-111707980 GGGCCCAGGACCAGGGCAGAAGG - Intergenic
936460585 2:112711353-112711375 AGCACCAGGACCCTTGGAGAGGG - Intergenic
936537006 2:113320339-113320361 GGCCAGAGGACCCTGGCTGCTGG + Intergenic
937258997 2:120573447-120573469 GGCCCCAGGTCCAAGGAAGAGGG + Intergenic
937292016 2:120787484-120787506 GACCCCAGTAGCCTGGCACACGG - Intronic
937886324 2:126901976-126901998 GGCCCCAGGACCCAGGATGGAGG - Exonic
938447667 2:131390707-131390729 AGCCCCAGCACCCAGGCAGTGGG - Intergenic
938570951 2:132561372-132561394 GGAGCCAGGACCATGGCTGATGG - Intronic
938686524 2:133743170-133743192 GGCCTCAGAACCATGGCAGGAGG + Intergenic
938743322 2:134253336-134253358 GGGCCCAGGACTCTGGCTGAAGG + Intronic
939672756 2:145033870-145033892 GGCCTCAGAACCATGGCAGGAGG + Intergenic
941881244 2:170482510-170482532 GGCCTCAGAATCATGGCAGAAGG - Intronic
942817334 2:180067320-180067342 GGCCTCACGATCATGGCAGAAGG + Intergenic
943701799 2:190995395-190995417 GGCCCCACAATCATGGCAGAAGG + Intronic
944157210 2:196620071-196620093 GCCACCAGGACCCTGCAAGATGG + Intergenic
944167947 2:196743116-196743138 GGCCCCAGGATCCCGGCAAGGGG - Intronic
945243548 2:207698196-207698218 GGGCCCAGGTGCCTGGAAGAGGG - Intergenic
945610239 2:211992252-211992274 GGCCCCAGAATCATGGCAGGAGG + Intronic
945634624 2:212332302-212332324 GGCCTCACAACCATGGCAGAAGG - Intronic
945959389 2:216116544-216116566 GGCCCCAGGGACCTGCCATAGGG + Intronic
946574134 2:221056389-221056411 GGCCTCAGGATCATGGCAGGAGG + Intergenic
947593115 2:231396086-231396108 CGCTCCAGGACCCTGGCGGCTGG + Intronic
947594198 2:231400528-231400550 GGGCCAAGGTCCCTGGCACAGGG - Exonic
947888707 2:233596598-233596620 GGCCTCACAATCCTGGCAGAAGG - Intergenic
948092529 2:235306567-235306589 GGCCTCAGAATCATGGCAGAAGG + Intergenic
948250499 2:236524740-236524762 GCCCCCAGGTCCCAGGCACATGG + Intergenic
948286455 2:236789723-236789745 GTCCCCAGGACCCTGGGAGGAGG + Intergenic
948479595 2:238241133-238241155 GTCCCCAGGACGCTGCCCGAGGG - Intergenic
948727540 2:239944196-239944218 GGCCTCAGGATCTTGGCAGGAGG - Intronic
1168802122 20:650359-650381 GGCCCAAGGGGTCTGGCAGAAGG + Intronic
1169424240 20:5484094-5484116 GTGGCCAGCACCCTGGCAGAGGG + Intergenic
1170313990 20:15023576-15023598 GGCCTCACGATCATGGCAGAGGG + Intronic
1170485534 20:16811995-16812017 GGCCTCACGAGCATGGCAGAAGG - Intergenic
1172106862 20:32522191-32522213 GGCCCCTGGACTCTGCCAGTGGG - Intronic
1172200342 20:33121684-33121706 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1172629224 20:36367058-36367080 GCCCCAAGGTTCCTGGCAGAGGG - Exonic
1172633501 20:36394207-36394229 AGCCCCTGGAGCCTGGGAGATGG - Intronic
1172740153 20:37160297-37160319 GGCCCCAGATGCCTGGCAGCAGG + Intronic
1172747428 20:37223058-37223080 TGCTCCAGGACCCTGGCTGAAGG + Intronic
1173224654 20:41155195-41155217 GGCCCCAGGTGCCAGGCAGCAGG + Intronic
1173225752 20:41161673-41161695 GGCCCCAAGAGCCTGGGAGGAGG - Intronic
1173282901 20:41645206-41645228 GGCCTCACGATCATGGCAGAAGG - Intergenic
1173491752 20:43488270-43488292 GGCCTCACAACCATGGCAGAAGG + Intergenic
1174046666 20:47738723-47738745 GGCCTCAGGATCATGGCAGAAGG - Intronic
1174159771 20:48542560-48542582 GGCCTCACGATCATGGCAGAGGG + Intergenic
1174407248 20:50310368-50310390 GTCCCCTGAACCCTGGAAGAAGG + Intergenic
1174517794 20:51106473-51106495 GGCCTCACGATCATGGCAGAAGG + Intergenic
1175741343 20:61421712-61421734 GGCACCAGAACCCCGGCAGGGGG - Intronic
1175900880 20:62359469-62359491 GGCCCCAGGCCCCAGGCCCAGGG - Intronic
1176004387 20:62852342-62852364 GGGCCCAGGACCCTGGAACTCGG + Intronic
1176120090 20:63450403-63450425 AGCCCCAGGGCCCTGGGAGCGGG - Intronic
1176139608 20:63539211-63539233 GGAACCAGGACCCCTGCAGATGG - Intergenic
1176425547 21:6546161-6546183 GGCCACGAGACCATGGCAGAAGG - Intergenic
1177026185 21:15924646-15924668 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1177438844 21:21091571-21091593 GGCCTCAGAATCATGGCAGAAGG + Intronic
1177599121 21:23288173-23288195 GGCCTCATGATCATGGCAGAAGG - Intergenic
1177836708 21:26192854-26192876 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1178749099 21:35283743-35283765 GGTCCCAGGACACTCCCAGAAGG + Intronic
1179701038 21:43154478-43154500 GGCCACGAGACCATGGCAGAAGG - Intergenic
1180063782 21:45402806-45402828 GCCTCCAGGACCCTGGTGGAGGG + Intergenic
1180219880 21:46351926-46351948 GGCCACAGGAGCCTGGCAGCAGG - Intronic
1180696355 22:17753898-17753920 GTCTCCAGGACTCTGCCAGATGG + Intronic
1180841211 22:18959722-18959744 GTCCCCAGCACCCTTCCAGAAGG - Intergenic
1180956718 22:19744542-19744564 TGCCCCAGGACCCTTGCACAGGG + Intergenic
1181022770 22:20112405-20112427 GGCCCCTGGCCCCTAGCAGCAGG + Exonic
1181042405 22:20198339-20198361 GGGCCCAGGACCCTGGGAGGAGG + Intergenic
1181060287 22:20279072-20279094 GTCCCCAGCACCCTTCCAGAAGG + Intronic
1181126008 22:20702822-20702844 CGCCCCAGGACCCTGTCCGCAGG + Intergenic
1181264767 22:21624490-21624512 TGCCGCAGCACCCTGGCAGTGGG - Intergenic
1181359290 22:22322652-22322674 GGGCCCAGGACCCTGGAAGCAGG - Intergenic
1181360057 22:22327496-22327518 GGGCCCAGGACCCTGGAAGTGGG - Intergenic
1181369390 22:22404404-22404426 GGGCCCAGGACCGTGGAAGCAGG - Intergenic
1181370280 22:22409962-22409984 GGGCCCAGGACCCTGGAAGTGGG - Intergenic
1181390901 22:22579994-22580016 GGGCCCAGGACCCTGGAAAGAGG - Intergenic
1181391799 22:22588370-22588392 GGGCCCAGGACCCTGGAAAGAGG - Intergenic
1181407963 22:22698103-22698125 GGGCCCAGGACCCTGGAAAGAGG - Intergenic
1181415957 22:22758893-22758915 GGGCCCAGGACCCTGGAAAGAGG - Intronic
1181593144 22:23896761-23896783 GGCCACAGGGCCCTTGCAGGGGG - Intronic
1182022340 22:27091403-27091425 GAGCCCATGTCCCTGGCAGATGG - Intergenic
1182182229 22:28362351-28362373 GGCCTCAGAATCATGGCAGAAGG - Intronic
1182298937 22:29327364-29327386 GGCCCCTGGAGCCTCCCAGATGG + Intergenic
1182330461 22:29547946-29547968 GGCCTCAGGAACATGGCAGGAGG + Intronic
1182548359 22:31088408-31088430 GTACCCAGAACCTTGGCAGAAGG - Intronic
1182938381 22:34249031-34249053 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1183213780 22:36466508-36466530 GGCCCTAGGAGCAAGGCAGACGG + Intergenic
1183214026 22:36467696-36467718 GGCCCCAGGAGCCAGACAGGAGG + Exonic
1183220119 22:36506850-36506872 GGCGCGCGGACCCTGGCAGGGGG - Intronic
1183361720 22:37386393-37386415 GGCTCCAGGACCCTGGGTGCTGG - Intronic
1183442367 22:37830379-37830401 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1183508796 22:38223321-38223343 GGCCCCAGGCCCCAGGCCCAAGG + Intronic
1183703595 22:39463484-39463506 GGGCCCAGGACAGTGGCAGAAGG - Intronic
1184036567 22:41920816-41920838 GTCCCCAGGGCCCTGGCCGGTGG - Intergenic
1184138536 22:42563722-42563744 GGCCCAAGGACCAGAGCAGAAGG + Intronic
1184291941 22:43502067-43502089 GGCTCCAGGAGGCTGGCAGCGGG + Intronic
1184381144 22:44145563-44145585 GCCCCCAGGAACCTGGAGGATGG + Intronic
1184644851 22:45890119-45890141 GGCCCCAGGACCCTGCCTCTGGG - Intergenic
1184645593 22:45893047-45893069 GGCCACAGGGCCCTGGCCGGAGG - Intergenic
1184765171 22:46568483-46568505 GGCCCCAGGGAAGTGGCAGAGGG - Intergenic
1184876174 22:47277139-47277161 GGCACCTGGACCCCGGCAGCAGG - Intergenic
1184962591 22:47942356-47942378 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1185050159 22:48550231-48550253 GGCTCCAGGGCCTGGGCAGATGG + Intronic
1185315979 22:50179307-50179329 GGCCACACGACACAGGCAGAGGG - Exonic
949676812 3:6464019-6464041 GTCCCCAAGACACTTGCAGAAGG - Intergenic
949745933 3:7292030-7292052 GGCCTCACGATCATGGCAGAAGG - Intronic
950421835 3:12904013-12904035 GGGCCCAGGAGCCTGGAAGAAGG + Intronic
950623938 3:14230601-14230623 GCCCACAGGTCCCTGGCTGATGG + Intergenic
950696062 3:14702145-14702167 GGCCCCAGAATCATGGCAGGAGG + Intronic
950856707 3:16112538-16112560 GGCCCCACAACCATGGCAGAAGG + Intergenic
950908865 3:16566657-16566679 GGCCTCACGATCATGGCAGAAGG + Intergenic
954291770 3:49653674-49653696 GGTCCCAGGGCCCTGGGAAAAGG - Exonic
954574517 3:51668337-51668359 GGCCCCAGGGTCCTGGCACCTGG + Exonic
954591720 3:51788896-51788918 GGCCTCACAATCCTGGCAGAGGG - Intergenic
956018860 3:64912570-64912592 GGCCTCACAACCATGGCAGAAGG - Intergenic
956185535 3:66558964-66558986 GGCCTCAGAATCATGGCAGAAGG + Intergenic
956367868 3:68524596-68524618 GGGCTCAGGATCCTGGGAGATGG - Intronic
956524195 3:70139519-70139541 TGCCACAGGACCCAGACAGAGGG - Intergenic
956813120 3:72884190-72884212 GGCCTCAGAATCATGGCAGAGGG - Intergenic
959006768 3:101028433-101028455 GGCCTCACAACCATGGCAGAAGG + Intergenic
959268062 3:104168705-104168727 GGCCTCATGACCATGGTAGAAGG + Intergenic
959730137 3:109591602-109591624 GGCCCCACAAACGTGGCAGAAGG + Intergenic
960811586 3:121632065-121632087 GGCCCGAGGAGCCTGGTACATGG - Intronic
961083386 3:124045135-124045157 GGACCCGGGAGACTGGCAGATGG + Intergenic
962045641 3:131756980-131757002 GGCCTCAGGATCATGGCAGGAGG - Intronic
963815819 3:149830010-149830032 GGCCTCAGAATCATGGCAGAAGG - Intronic
963816767 3:149839484-149839506 GGCCTCAGAATCATGGCAGAAGG + Intronic
964231454 3:154474665-154474687 GGCCCCACGATCATGGCAGCAGG - Intergenic
964569313 3:158094849-158094871 GGCCACAGGACCACGGCGGATGG + Intergenic
965202270 3:165674930-165674952 GGCCTCATGATCATGGCAGAAGG - Intergenic
968038969 3:195572542-195572564 GGCCCCATGAACTTGGGAGAAGG + Intronic
968365883 3:198184208-198184230 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
968581207 4:1396214-1396236 GTCCCCATGAGCCAGGCAGATGG + Intergenic
968613531 4:1567523-1567545 GGCCCCACAACCCAGGCTGAAGG + Intergenic
968641811 4:1718556-1718578 GGCCTCAGGGGCCTGGCTGAGGG + Exonic
968712385 4:2128350-2128372 GGTCAGAGGACCCTGGGAGATGG - Intronic
968950901 4:3690909-3690931 GGCCCCAGGGCCCTGCCATGGGG + Intergenic
969047343 4:4345993-4346015 AGCCCCAGGACACTGACACAGGG - Intergenic
969297528 4:6278646-6278668 GGCCCCACGGCCCTGCCAGTGGG - Intronic
970213921 4:13738914-13738936 GGCCTCACGATCTTGGCAGAAGG + Intergenic
970730675 4:19100004-19100026 GGCCTCACGATCATGGCAGAAGG - Intergenic
970763157 4:19516089-19516111 GGCCTCACGATCATGGCAGAAGG - Intergenic
970789096 4:19835382-19835404 GGCCTCAGAATCATGGCAGAAGG - Intergenic
971357599 4:25909081-25909103 GGCCTCACAACCGTGGCAGAAGG + Intronic
972002537 4:34057599-34057621 GGCCTCAGAATCATGGCAGAAGG + Intergenic
972002794 4:34059517-34059539 GGCCACAGAATCATGGCAGAAGG + Intergenic
972240860 4:37190135-37190157 GGCCTCATGATCATGGCAGAAGG + Intergenic
972447905 4:39164320-39164342 GGCCCCACAATCATGGCAGAAGG - Intergenic
972993754 4:44853251-44853273 GGCCTCACGATCATGGCAGAAGG - Intergenic
973063992 4:45764458-45764480 GGCCTCACGATCATGGCAGAAGG + Intergenic
974144987 4:57936250-57936272 GGCCTCAGAATCATGGCAGAAGG - Intergenic
975690306 4:76956551-76956573 GCCTCCAGGACCCAGGCTGAGGG + Intronic
975949667 4:79754438-79754460 GGACTCAGGACCCAGGCTGAAGG - Intergenic
976209265 4:82651170-82651192 GTCCCCAAGACCCTTTCAGAGGG - Intronic
976514231 4:85945991-85946013 GGCCTCACAATCCTGGCAGAAGG + Intronic
976668571 4:87627011-87627033 GGCCCCATGATCATGGCAGAAGG + Intergenic
977031892 4:91893665-91893687 GGCCTCAGAATCATGGCAGAAGG + Intergenic
978895724 4:113885182-113885204 GGCCCCATGAGCTTGGCAAAAGG + Intergenic
978920158 4:114174458-114174480 GGCCTCACAACCATGGCAGAAGG + Intergenic
979254920 4:118599366-118599388 GTCCCCAGGACCGTGTGAGAAGG - Intergenic
979334047 4:119446653-119446675 GTCCCCAGGACCCTGTGAGAGGG + Intergenic
980598418 4:134987288-134987310 GGCCTCACAATCCTGGCAGAAGG - Intergenic
982214754 4:153071413-153071435 GGCCTCAGAATCATGGCAGAAGG + Intergenic
982403438 4:154994510-154994532 GACCCCTGGACCCAGCCAGAAGG + Intergenic
982829404 4:160042276-160042298 GGCCTCAGAATCATGGCAGAAGG + Intergenic
982858512 4:160416836-160416858 GGCCGAAGGACTCAGGCAGATGG - Intergenic
983911017 4:173239580-173239602 GGACCCAGGACCATGGGAGGAGG + Intronic
983939085 4:173522956-173522978 GGGCCCAGGACCCTGGTTGGAGG - Intergenic
984483606 4:180337320-180337342 GGCCCCACAATCATGGCAGAAGG + Intergenic
984845822 4:184107068-184107090 TGCCCCAGGCCCCTGGGGGAGGG + Intronic
985578387 5:684216-684238 GGCCCCAGGACGCTGACTGAGGG + Intronic
985784787 5:1887871-1887893 GGCACCAGGACCCGGGCAAGTGG + Intergenic
986202432 5:5590469-5590491 GGCCTCACGATCATGGCAGAAGG + Intergenic
986447229 5:7832096-7832118 GCTCCCAGGACCCAGGCTGATGG - Intronic
987122045 5:14776905-14776927 GGCCCCAGGTGCATGGCACAAGG + Intronic
987207153 5:15639515-15639537 GGCCTCATGATCATGGCAGAAGG - Intronic
988204523 5:28116379-28116401 GGCCTCAGAATCATGGCAGAGGG + Intergenic
988351645 5:30116305-30116327 GGCCTCAGTATCATGGCAGAAGG - Intergenic
988888187 5:35582288-35582310 GGCCTCAGAATCATGGCAGAAGG + Intergenic
988924898 5:35979842-35979864 GGCCCCACAATCATGGCAGAAGG + Intronic
989212376 5:38868601-38868623 GGCCCCAGAATCATGGCAGGAGG - Intronic
989783818 5:45302898-45302920 GGCCTCAGAATCATGGCAGAAGG - Intronic
990660298 5:58006671-58006693 GGCCCCACAATCATGGCAGAAGG - Intergenic
990701178 5:58476387-58476409 GGTCCCAGAATCATGGCAGAAGG + Intergenic
992629417 5:78666201-78666223 GGCCCGGGGTCCCTGGCAGTCGG + Intronic
993068238 5:83127489-83127511 GGCCCCAGAATCATGGCAGAAGG - Intronic
993416720 5:87642419-87642441 GGCCTCACAACCATGGCAGAAGG - Intergenic
993510944 5:88770986-88771008 GGCCTCAGAATCATGGCAGAAGG + Intronic
996038303 5:118782774-118782796 GCCCCAAGGACCCAGGTAGAAGG - Intergenic
996194677 5:120589592-120589614 GGCCTCAGAACCATGGCAGGGGG + Intronic
996268335 5:121570952-121570974 GGCCTCACGATCATGGCAGAAGG + Intergenic
997276544 5:132597567-132597589 GGCCTCAGGTCCTTGGCATATGG - Intronic
997588004 5:135055570-135055592 GGCCCCAGCTGCCAGGCAGACGG + Intronic
997610782 5:135214105-135214127 GGCTCCAGGACCCTGCCAGCAGG + Intronic
997697496 5:135873101-135873123 GGCCCCATTGTCCTGGCAGAAGG + Intronic
997879467 5:137576541-137576563 GGCCTCACAACCATGGCAGAAGG + Intronic
998565143 5:143210194-143210216 GGCCTCACAATCCTGGCAGAAGG + Intronic
998723140 5:144976493-144976515 GGCCTCAGAATCATGGCAGAAGG - Intergenic
999239274 5:150118199-150118221 GGTCCCAGGGACCTGGGAGATGG - Intronic
999371774 5:151060043-151060065 GGTGCCTGGCCCCTGGCAGAAGG + Intronic
999436763 5:151569273-151569295 GGCCCCATAATCATGGCAGAAGG + Intergenic
1000226361 5:159265760-159265782 GGCCTCAGAATCATGGCAGAAGG - Intronic
1000430320 5:161143760-161143782 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1001646463 5:173285459-173285481 GGCCTCACGATCATGGCAGAAGG - Intergenic
1002048443 5:176555276-176555298 GGCCCCAGGGCCCTAGCAAGAGG - Intronic
1002725109 5:181289432-181289454 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1003352115 6:5327594-5327616 GGCCTCACGATCATGGCAGAAGG - Intronic
1003511092 6:6781278-6781300 GGCAGCAGGAACCTGGCAGGAGG + Intergenic
1003897839 6:10624312-10624334 GGCCTCACAATCCTGGCAGAGGG + Intronic
1004553341 6:16671431-16671453 GGCCTCAGGAGCTAGGCAGATGG + Intronic
1004747194 6:18522795-18522817 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1004990636 6:21134047-21134069 GCCCCCACGACCCCGGCAAATGG - Intronic
1005153478 6:22778475-22778497 GGCCTCATGATCATGGCAGAAGG - Intergenic
1005232696 6:23722743-23722765 GCCCCCAGAACCCTGGTACATGG - Intergenic
1005685874 6:28252571-28252593 GCCCCAAGAACCCTGGCAGGGGG + Intergenic
1006129633 6:31861528-31861550 GGCCTGAGGTCCCTAGCAGAAGG - Intronic
1006428606 6:33981681-33981703 GGCCCCAGGCCCCAAGCGGAAGG - Intergenic
1006835844 6:36998425-36998447 GCCCCCGGGACACTGGGAGACGG - Intergenic
1006981188 6:38149617-38149639 AGCCCCAGGACTCTGGAAAAAGG - Intronic
1007414676 6:41684566-41684588 GGCCCCTGTTCCCTGGCACAGGG + Exonic
1007426361 6:41748712-41748734 GTCCTCAGGCCCCAGGCAGAAGG + Intronic
1007605622 6:43115983-43116005 GGACCCAGGCCCATGGGAGAGGG - Intronic
1008242118 6:49126646-49126668 GGCCTCACGACCATGGCAGAAGG - Intergenic
1010324200 6:74545848-74545870 GGCCTCACGATCATGGCAGAAGG + Intergenic
1011348874 6:86401014-86401036 GGCCTCACGATCATGGCAGAAGG + Intergenic
1011472004 6:87717441-87717463 GGCTCCTGGACTCTGGAAGATGG - Intergenic
1012169305 6:95999051-95999073 GGCCTCATGATCATGGCAGAAGG + Intergenic
1012675129 6:102104358-102104380 GCCCCCAGGACTCTGGCCCAAGG + Intergenic
1013076894 6:106779781-106779803 GGCCTCATGATCATGGCAGAAGG - Intergenic
1013453592 6:110309568-110309590 GGCCTCAGAATCATGGCAGAAGG + Intronic
1013684028 6:112558152-112558174 GGCCCCAGAACCAAGGAAGATGG + Intergenic
1013863021 6:114659560-114659582 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1014133596 6:117863180-117863202 GGCCTCACGATCATGGCAGAAGG - Intergenic
1014211737 6:118715499-118715521 GTTCCCAGGATCCTGACAGAAGG - Intergenic
1014449245 6:121564563-121564585 GGCCTCACAATCCTGGCAGACGG - Intergenic
1014863373 6:126497577-126497599 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1015513078 6:134058871-134058893 GCTCCCAGGGCCATGGCAGAGGG + Intergenic
1015523056 6:134150700-134150722 GGCCCCAGAATCATGGCAGGAGG - Intergenic
1015560427 6:134509439-134509461 GTCCCCAGGATCCTTTCAGAAGG - Intergenic
1015877124 6:137834038-137834060 GGCCTCAGAATCCCGGCAGAAGG - Intergenic
1016419866 6:143872649-143872671 GGCCTCAGAATCATGGCAGAAGG + Intronic
1016460234 6:144274075-144274097 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1017031797 6:150230363-150230385 GCCCCCAGGCCCAGGGCAGATGG + Intronic
1017514375 6:155142540-155142562 GGCCCGAGGACCAGGGCAAAGGG - Intronic
1017820298 6:158044225-158044247 ACCCCCTGGAACCTGGCAGATGG - Intronic
1018374793 6:163200906-163200928 GGCCCCAGAACCCAGGCACTGGG + Intronic
1018374809 6:163200944-163200966 GGCCCCAGGCCCCAGGCACTGGG + Intronic
1018389286 6:163330271-163330293 GGCCCCAGAACACTGGGAGGGGG - Intergenic
1018748584 6:166781756-166781778 GGAGCCAGGAGCCAGGCAGATGG + Intronic
1018906865 6:168080619-168080641 GGGCGCAGGACAGTGGCAGAGGG + Intronic
1019037966 6:169077986-169078008 GGCCCCAGGGCCCTGCTAGAAGG + Intergenic
1019067135 6:169311835-169311857 GGCCTCAGGATCATGGCGGAAGG + Intergenic
1019463423 7:1173387-1173409 GGCCCCGGCAACCTGGCAGAGGG - Intergenic
1019505145 7:1386808-1386830 GGCCACAGCACCCAGGCAGCGGG + Intergenic
1019506621 7:1394696-1394718 GCTCCCAGGACCCTGCCACATGG + Intergenic
1019631809 7:2053544-2053566 GGCCCCAAGGCCCTGGCGGGCGG + Intronic
1020100251 7:5390425-5390447 GGCCCCAGAAGCCTCTCAGAAGG + Intronic
1020537726 7:9423329-9423351 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1020754918 7:12190276-12190298 GGCCTCACAATCCTGGCAGAAGG + Intergenic
1021174814 7:17439052-17439074 GGCCCCACAATCATGGCAGAAGG + Intergenic
1021177248 7:17463227-17463249 GGCCTCACGATCATGGCAGAAGG - Intergenic
1021598445 7:22341165-22341187 GGCCTCAGAATCATGGCAGAAGG + Intronic
1024070009 7:45777043-45777065 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1024191692 7:47018375-47018397 GGCCTCACAACCATGGCAGAAGG + Intergenic
1025187288 7:56871155-56871177 GTCCCCAGGACCCTGGGAGAGGG + Intergenic
1025188707 7:56880963-56880985 GTCCCCAGGACCCTGGGAGAGGG + Intergenic
1025683227 7:63695957-63695979 GTCCCCAGGACCCTGGGAGAGGG - Intergenic
1025684637 7:63705765-63705787 GTCCCCAGGACCCTGGGAGAGGG - Intergenic
1025744372 7:64230084-64230106 GGAAGCAGGACCCAGGCAGAAGG + Intronic
1025751601 7:64298622-64298644 GGAAGCAGGACCCAGGCAGAAGG + Intergenic
1026038443 7:66846197-66846219 GTCCCCAGGACCGTGTAAGAGGG - Intergenic
1026532729 7:71213293-71213315 GGCCTCAGAATCATGGCAGAAGG - Intronic
1026552675 7:71381408-71381430 GGCCCAAGGAACTTGGCAAAAGG + Intronic
1026573057 7:71548640-71548662 GGCCTCACGATCGTGGCAGAAGG - Intronic
1027212955 7:76165389-76165411 GTCCCCAGGACCCTGTAAGAGGG + Intergenic
1027269659 7:76512654-76512676 GGCACCAGGAGCCCCGCAGAGGG - Intronic
1027320369 7:77006548-77006570 GGCACCAGGAGCCCCGCAGAGGG - Intergenic
1029188174 7:98754325-98754347 GGGGCCAGGACCCAAGCAGAGGG - Intergenic
1029711305 7:102301406-102301428 GGTGCCAGGACCCTGGGAGGTGG + Intronic
1031301500 7:120067147-120067169 GGCCTCACAACCATGGCAGAAGG - Intergenic
1032047407 7:128621331-128621353 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1032179347 7:129661949-129661971 GGCCTCACAACCATGGCAGAAGG + Intronic
1032215250 7:129952588-129952610 GGCCCCGGGCCCGTGACAGACGG - Exonic
1032779877 7:135157006-135157028 GGCCTCAGAATCCTGGCAGGAGG - Intronic
1033613137 7:142984816-142984838 GGCCTCTGGAACCTGGCAGGAGG - Intergenic
1033833212 7:145277441-145277463 GGCCCCACAATCATGGCAGAAGG - Intergenic
1034037185 7:147837207-147837229 GGCCCCACAATCATGGCAGAAGG + Intronic
1034134870 7:148757770-148757792 GGCCTCACAACCATGGCAGAAGG + Intronic
1034243204 7:149624963-149624985 GGCCCCGCGACCCAGGCCGAGGG + Intergenic
1034687657 7:152987343-152987365 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1034707298 7:153157000-153157022 GGCCTCAGGACCATGGCAGGAGG + Intergenic
1034822377 7:154228307-154228329 GAGCCAAGGACCCTTGCAGAAGG - Intronic
1035234441 7:157487396-157487418 GGCCCCAGAGCCTTGGGAGAGGG + Intergenic
1035334124 7:158114698-158114720 GGCCCCAGGGCCGTGGCCGGTGG - Intronic
1035657432 8:1320474-1320496 GGCATCAGGAGCCGGGCAGACGG + Intergenic
1035674234 8:1443607-1443629 GGCCTCACGATCATGGCAGAAGG + Intergenic
1036457552 8:8923349-8923371 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1036646240 8:10612662-10612684 TGCCCCAGGACCCCGGAGGACGG - Exonic
1037357986 8:18043053-18043075 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1037388161 8:18365076-18365098 GGCCTCACGACCATGGCAGCGGG - Intergenic
1037876227 8:22550040-22550062 GTCCCAAGGACCCTGACAGGTGG + Intronic
1038536974 8:28360407-28360429 AGACCCAGGGCCCTGGCACAGGG + Intronic
1038612632 8:29069919-29069941 GGGCCCTGGGCTCTGGCAGATGG - Exonic
1038651744 8:29410102-29410124 GGCCCCGGGACCTTGTCAGAAGG + Intergenic
1039657394 8:39424409-39424431 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1040599823 8:48872260-48872282 AGACCCAGGACCGTGGCTGAAGG + Intergenic
1041673728 8:60517289-60517311 GGCCTCCGGACCCGGGCTGAGGG + Intronic
1041739078 8:61139573-61139595 GGACCCAGGGCCCGTGCAGAAGG + Intronic
1041752750 8:61278851-61278873 GGCCCCAGGAGCATGGGAGTAGG - Intronic
1042176083 8:66037967-66037989 GGGCCCAGGAGGCAGGCAGAGGG + Intronic
1042412392 8:68480309-68480331 GGCCTCAGAACCATGGCAGGAGG - Intronic
1042653530 8:71069481-71069503 TCCCTCAAGACCCTGGCAGAAGG - Intergenic
1044737818 8:95297228-95297250 GGCCTCACAACCATGGCAGAAGG + Intergenic
1045736148 8:105297951-105297973 GGCCTCACAACCATGGCAGATGG + Intronic
1046368803 8:113272582-113272604 GGCCTCAGAATCATGGCAGAAGG - Intronic
1047115458 8:121836993-121837015 GGCCCCACCATCATGGCAGAAGG - Intergenic
1047621671 8:126613849-126613871 GGCCTCACAACCATGGCAGAAGG - Intergenic
1048375397 8:133818511-133818533 GGCCCCACAATCATGGCAGAAGG - Intergenic
1048404464 8:134105909-134105931 GGCCTCACAACCATGGCAGAAGG - Intergenic
1048700146 8:137079012-137079034 GGCCTCAGGATCATGGCAAAAGG - Intergenic
1048780592 8:137995259-137995281 GGCCCCACAATCATGGCAGAAGG - Intergenic
1048987769 8:139744402-139744424 GGCTCCAGCACCCTGAGAGAAGG - Intronic
1049355705 8:142187099-142187121 ATACCCAGGATCCTGGCAGAGGG + Intergenic
1049466087 8:142751891-142751913 GCCCAGAGGCCCCTGGCAGATGG - Intronic
1049476008 8:142797319-142797341 GGTCCCAGGACCCCAGCAAAGGG + Intergenic
1049522323 8:143099766-143099788 GGCCTCACAACCATGGCAGAAGG + Intergenic
1049620642 8:143597051-143597073 GGCCCCAGCAGCCTGGCCGAGGG + Intronic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1050082555 9:1930313-1930335 GGCCACACAACCATGGCAGAAGG + Intergenic
1050755646 9:9000001-9000023 GCCACCAGGACTCTGGCATATGG - Intronic
1050832149 9:10028216-10028238 GGCCTCACGATCATGGCAGAAGG - Intronic
1050921765 9:11212611-11212633 GGCCCCACCATCATGGCAGAAGG + Intergenic
1051127312 9:13819051-13819073 GGCCTCACGATCATGGCAGAAGG - Intergenic
1051355851 9:16239279-16239301 GGCCTCACAACCATGGCAGAAGG - Intronic
1051379309 9:16439127-16439149 GGCCCCACAATCATGGCAGAAGG - Intronic
1052025205 9:23566306-23566328 AGCCCCAGGAACCTGGAGGAAGG - Intergenic
1052158593 9:25226582-25226604 GGCCGCTCGACACTGGCAGAGGG + Intergenic
1052518041 9:29509304-29509326 GGCCTCACAACCATGGCAGAAGG + Intergenic
1052532685 9:29708172-29708194 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1052982326 9:34458333-34458355 GGCCCCAGGAGCCCGGCGGGTGG + Exonic
1053221524 9:36317023-36317045 GGCCCCAGCACCCAGGCACAGGG + Intergenic
1053267669 9:36726740-36726762 TGTCCCAGGACCCTGGTTGAGGG + Intergenic
1053362762 9:37501044-37501066 GGCCCCAGGAGCCTTCCAAATGG - Intronic
1053425770 9:38008956-38008978 GGACTCAGGACCCAGACAGAAGG + Intronic
1053868639 9:42467635-42467657 GGCCTCAGGATCATGGCGGAAGG + Intergenic
1055168039 9:73220219-73220241 GGCCCCACCATCCTGGCAGAAGG - Intergenic
1056116476 9:83446257-83446279 GGCCGCTGGGCTCTGGCAGAAGG - Intronic
1056638510 9:88350559-88350581 GGCCTCAGAATCATGGCAGAGGG + Intergenic
1057140460 9:92723836-92723858 GGGCCCAGGTCCCTGGCACATGG - Intronic
1057182932 9:93039657-93039679 GCCCCCAGGACATGGGCAGAGGG + Intergenic
1057186810 9:93061689-93061711 ACCCCCAAGACCCTGGCAGTGGG - Intronic
1057231668 9:93325131-93325153 GGCACCAGCACCCTCGCTGATGG + Intronic
1057316599 9:93972975-93972997 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1057442674 9:95093231-95093253 GAGCACAGGGCCCTGGCAGATGG + Intergenic
1058940659 9:109809924-109809946 GGCCTCACAATCCTGGCAGAAGG - Intronic
1058960547 9:109988997-109989019 GGCCCCACAATCATGGCAGAAGG - Intronic
1059333061 9:113548641-113548663 GGCTCCAGGACTCTCCCAGATGG - Intronic
1059445020 9:114332620-114332642 AGCCCCAGGATCCTGGGACAGGG + Intronic
1059587503 9:115621727-115621749 GGCCTCACGATCATGGCAGAAGG + Intergenic
1060524163 9:124311191-124311213 GGAGCCAGCACCCTGGCGGAAGG - Intronic
1060744667 9:126123403-126123425 GGCCCCTTGTCCCTGACAGAAGG + Intergenic
1061130581 9:128705741-128705763 GGCCTCAGGACCCCGGCCGTGGG + Exonic
1061224283 9:129271705-129271727 GTCCCCAGTCCCCAGGCAGAGGG - Intergenic
1061838430 9:133343927-133343949 AGGCCCAGGGCCCTGGCATATGG + Intronic
1061991233 9:134159775-134159797 GGCCCCAGGACCCCCACAGCAGG - Exonic
1062102253 9:134734379-134734401 GGCCCCAGGACACTTGGAGCAGG - Intronic
1062268716 9:135699276-135699298 GAGCCCTGGACCCTGGGAGAGGG - Intronic
1062384332 9:136303157-136303179 GGAACCAGGACCCTGGGGGAAGG - Exonic
1062419899 9:136475472-136475494 GGCCCCTGGGTCCTGGCTGAAGG + Exonic
1062750253 9:138247075-138247097 GTCCCCAGGACCCTGTGAGAGGG - Intergenic
1185540139 X:896782-896804 GGCCACAGGACACTCACAGAAGG - Intergenic
1185737756 X:2505986-2506008 GGCCTCACGATCATGGCAGAAGG - Intergenic
1185823268 X:3225182-3225204 GGCCTCACGATCATGGCAGAAGG - Intergenic
1185852723 X:3504326-3504348 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1186116432 X:6309282-6309304 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1186974637 X:14888517-14888539 GGCCTCACAACCATGGCAGAAGG - Intronic
1187680757 X:21765584-21765606 GGCCTCACGATCATGGCAGAAGG + Intergenic
1189411926 X:40780110-40780132 GGCCCCAGGACTCTGCCTCATGG + Intergenic
1189577960 X:42375505-42375527 GGCCCCAGGGCCTTTGCAGAAGG + Intergenic
1189636318 X:43014110-43014132 GGCCTCAGAATCATGGCAGAAGG - Intergenic
1190152185 X:47957773-47957795 AGCCCCAGCACTCAGGCAGAAGG - Intronic
1190331140 X:49236093-49236115 AACCCCAGGACCCTGGCACTCGG + Intronic
1190469591 X:50764908-50764930 GGCCCCACGATCATGGCAGAAGG + Intronic
1191126639 X:56962834-56962856 GGCCCCAAAATCATGGCAGAAGG + Intergenic
1191155100 X:57265653-57265675 GGCCAGAGAACACTGGCAGAGGG - Intergenic
1191856301 X:65629604-65629626 GGCCTCAGAACCATGGCAGGAGG + Intronic
1194024697 X:88737186-88737208 GGCCTCACAACCATGGCAGAAGG + Intergenic
1194220354 X:91182405-91182427 GGCCTCACAACCCTTGCAGAGGG - Intergenic
1194477635 X:94378567-94378589 GGCCTCACGATCATGGCAGAAGG + Intergenic
1194496475 X:94622313-94622335 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1194539717 X:95155942-95155964 GGCCCGAGGGCCCTGGTGGAGGG - Intergenic
1197561358 X:128025650-128025672 GGCCTCACAACCATGGCAGAAGG + Intergenic
1197715698 X:129704719-129704741 CCCCCCAGGATCCTGGCTGAAGG + Intergenic
1198614290 X:138438478-138438500 GGCCTCAGAATCATGGCAGAAGG + Intergenic
1198707096 X:139461371-139461393 GGCCTCAGGATCATGGCAGGAGG - Intergenic
1199027743 X:142960227-142960249 GGCCTCACGATCATGGCAGAAGG + Intergenic
1199409545 X:147504860-147504882 GGCCTCAGGATCATGGCAGAAGG - Intergenic
1199569224 X:149251417-149251439 GGCCTCACAACCATGGCAGAAGG + Intergenic
1200071967 X:153533696-153533718 GGCCCCGGGACCATGGCAGAGGG + Intronic
1200074368 X:153543907-153543929 GGCCCCAGGGCCCTGGCTGGAGG - Intronic
1200123844 X:153804055-153804077 GGCCTCAGGATCCCGGGAGAGGG + Exonic
1200556867 Y:4646157-4646179 GGCCTCACAACCCTTGCAGAGGG - Intergenic
1201547511 Y:15181671-15181693 GTCCTCACGACCATGGCAGAAGG - Intergenic
1201781846 Y:17731468-17731490 GACCCTTGGACCCTGGAAGAAGG - Intergenic
1201819707 Y:18174522-18174544 GACCCTTGGACCCTGGAAGAAGG + Intergenic