ID: 1145065474

View in Genome Browser
Species Human (GRCh38)
Location 17:19758640-19758662
Sequence CTGGGCTCAAGCAACCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145065474_1145065480 25 Left 1145065474 17:19758640-19758662 CCACCAGGGTTGCTTGAGCCCAG No data
Right 1145065480 17:19758688-19758710 ATCGAACCACTGCACTCCAGTGG No data
1145065474_1145065481 28 Left 1145065474 17:19758640-19758662 CCACCAGGGTTGCTTGAGCCCAG No data
Right 1145065481 17:19758691-19758713 GAACCACTGCACTCCAGTGGTGG No data
1145065474_1145065482 29 Left 1145065474 17:19758640-19758662 CCACCAGGGTTGCTTGAGCCCAG No data
Right 1145065482 17:19758692-19758714 AACCACTGCACTCCAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145065474 Original CRISPR CTGGGCTCAAGCAACCCTGG TGG (reversed) Intergenic
No off target data available for this crispr