ID: 1145065480

View in Genome Browser
Species Human (GRCh38)
Location 17:19758688-19758710
Sequence ATCGAACCACTGCACTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145065479_1145065480 6 Left 1145065479 17:19758659-19758681 CCAGGAGTTTGAGGCTGCAGTGA 0: 3779
1: 13820
2: 29201
3: 80850
4: 172327
Right 1145065480 17:19758688-19758710 ATCGAACCACTGCACTCCAGTGG No data
1145065476_1145065480 22 Left 1145065476 17:19758643-19758665 CCAGGGTTGCTTGAGCCCAGGAG No data
Right 1145065480 17:19758688-19758710 ATCGAACCACTGCACTCCAGTGG No data
1145065474_1145065480 25 Left 1145065474 17:19758640-19758662 CCACCAGGGTTGCTTGAGCCCAG No data
Right 1145065480 17:19758688-19758710 ATCGAACCACTGCACTCCAGTGG No data
1145065478_1145065480 7 Left 1145065478 17:19758658-19758680 CCCAGGAGTTTGAGGCTGCAGTG 0: 3560
1: 12931
2: 29169
3: 68642
4: 164538
Right 1145065480 17:19758688-19758710 ATCGAACCACTGCACTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145065480 Original CRISPR ATCGAACCACTGCACTCCAG TGG Intergenic
No off target data available for this crispr