ID: 1145065651

View in Genome Browser
Species Human (GRCh38)
Location 17:19759740-19759762
Sequence CAGGGGGCAGGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145065651_1145065667 29 Left 1145065651 17:19759740-19759762 CCCTCTGCCCTCCCTGCCCCCTG No data
Right 1145065667 17:19759792-19759814 CTGCCTGCTGGAGGAGAAGCGGG No data
1145065651_1145065666 28 Left 1145065651 17:19759740-19759762 CCCTCTGCCCTCCCTGCCCCCTG No data
Right 1145065666 17:19759791-19759813 CCTGCCTGCTGGAGGAGAAGCGG No data
1145065651_1145065661 17 Left 1145065651 17:19759740-19759762 CCCTCTGCCCTCCCTGCCCCCTG No data
Right 1145065661 17:19759780-19759802 GCCTCATTCCTCCTGCCTGCTGG No data
1145065651_1145065663 20 Left 1145065651 17:19759740-19759762 CCCTCTGCCCTCCCTGCCCCCTG No data
Right 1145065663 17:19759783-19759805 TCATTCCTCCTGCCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145065651 Original CRISPR CAGGGGGCAGGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr