ID: 1145065993

View in Genome Browser
Species Human (GRCh38)
Location 17:19761855-19761877
Sequence CCGTGGGCCTCTGCAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145065985_1145065993 -3 Left 1145065985 17:19761835-19761857 CCTCTTCCAAGTACCTCACCCCG No data
Right 1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG No data
1145065984_1145065993 5 Left 1145065984 17:19761827-19761849 CCTTGGAGCCTCTTCCAAGTACC No data
Right 1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG No data
1145065982_1145065993 19 Left 1145065982 17:19761813-19761835 CCCGTTGGGGTAATCCTTGGAGC No data
Right 1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG No data
1145065983_1145065993 18 Left 1145065983 17:19761814-19761836 CCGTTGGGGTAATCCTTGGAGCC No data
Right 1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG No data
1145065988_1145065993 -9 Left 1145065988 17:19761841-19761863 CCAAGTACCTCACCCCGTGGGCC No data
Right 1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145065993 Original CRISPR CCGTGGGCCTCTGCAGCTGC AGG Intergenic
No off target data available for this crispr