ID: 1145067350

View in Genome Browser
Species Human (GRCh38)
Location 17:19770747-19770769
Sequence TTGTTTCAGTGGGAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145067350_1145067358 25 Left 1145067350 17:19770747-19770769 CCTCCCACTTCCCACTGAAACAA No data
Right 1145067358 17:19770795-19770817 ATATGCAAAAACAAGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145067350 Original CRISPR TTGTTTCAGTGGGAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr