ID: 1145070459

View in Genome Browser
Species Human (GRCh38)
Location 17:19801276-19801298
Sequence CTCAAAAAGAAGTTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145070454_1145070459 0 Left 1145070454 17:19801253-19801275 CCTAACAAATTTATACAGAGATT 0: 1
1: 0
2: 0
3: 37
4: 445
Right 1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG 0: 1
1: 0
2: 7
3: 66
4: 543
1145070453_1145070459 11 Left 1145070453 17:19801242-19801264 CCAGTAGAGATCCTAACAAATTT 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG 0: 1
1: 0
2: 7
3: 66
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145070459 Original CRISPR CTCAAAAAGAAGTTGGGGCC GGG Intronic
900081338 1:860491-860513 AGCAAAAAGAAGGTGGGGCCAGG - Intergenic
901432747 1:9227355-9227377 ATAATAAAAAAGTTGGGGCCAGG + Intergenic
901466323 1:9423746-9423768 CTCAAAATGTAGTTCTGGCCAGG + Intergenic
901811976 1:11772560-11772582 CTTAAAGGGAAGTGGGGGCCAGG - Intronic
902148667 1:14424840-14424862 CTCAGCAAGCAGATGGGGCCTGG - Intergenic
902270519 1:15301123-15301145 ATTAAAAAAAAGTAGGGGCCGGG - Intronic
902977490 1:20099367-20099389 CTCAAAAAAAAGAGGGGGCGGGG + Intergenic
903993908 1:27293050-27293072 TTCATAAAGAAGAAGGGGCCAGG - Intronic
904244288 1:29175398-29175420 CTCAAAAAAAATTTCCGGCCGGG + Intronic
904249743 1:29214654-29214676 TAAAAAAAGAAGTTGGGGCCAGG - Intronic
904662787 1:32097626-32097648 AAAAAAAAGAAGTTGGGGCCGGG - Intronic
904691269 1:32294807-32294829 AAAAAAAAAAAGTTGGGGCCGGG - Intronic
904740943 1:32675472-32675494 ATCAAAAAGAAGGATGGGCCAGG + Intronic
904922241 1:34017459-34017481 CTCAAAAACATCTTGTGGCCAGG + Intronic
905348453 1:37327798-37327820 CTCCAAAAGAAGCTCAGGCCAGG + Intergenic
905551784 1:38847312-38847334 GTCAAAAAAAATTTGGGGTCTGG + Intronic
905559177 1:38912714-38912736 CTTAAAAAGAATCTGTGGCCAGG - Intronic
905911253 1:41656437-41656459 CCCACAAAGGAATTGGGGCCAGG - Intronic
906265857 1:44428851-44428873 CTGGATAAGAAGTTGGGGTCGGG + Intronic
906548277 1:46638321-46638343 TTTAAAAAGAAGTTTGGGCCAGG + Intronic
907180032 1:52561499-52561521 ATCAACAAAAATTTGGGGCCGGG + Intergenic
907882775 1:58566524-58566546 TTCAGAAAGAATTTGGGGCTTGG + Intergenic
907966438 1:59334437-59334459 ATGAAAAACAAGTGGGGGCCGGG - Intronic
908490798 1:64642233-64642255 CTGAAAAAAAAGGTGGGGCAGGG - Intronic
908662422 1:66451451-66451473 AACAAAAAGAAGTTGGGTGCTGG + Intergenic
908780028 1:67681893-67681915 TACAAAAATTAGTTGGGGCCAGG - Intergenic
910677240 1:89827053-89827075 ATCAAAAAGATTTTGGGGCTGGG + Intronic
910788851 1:91029876-91029898 CTTAAAATGCAGGTGGGGCCGGG - Intergenic
911003847 1:93197685-93197707 CTCAAAAACAAGTTATGGCAAGG + Intronic
911642301 1:100302350-100302372 TTTAAAAAGACTTTGGGGCCGGG - Intergenic
911676068 1:100659495-100659517 CTCAAAAGGAAGTAGAAGCCAGG - Intergenic
912106155 1:106278214-106278236 CGCATATTGAAGTTGGGGCCTGG - Intergenic
912548475 1:110467948-110467970 TTAAAAAATAAATTGGGGCCAGG + Intergenic
914769233 1:150668676-150668698 CACAAATATGAGTTGGGGCCAGG - Intronic
915492656 1:156259825-156259847 CACAAAAATAAGTTGGGGCCAGG - Intronic
916099441 1:161381530-161381552 TACAAAAAGAAGAAGGGGCCAGG + Intergenic
917068740 1:171126053-171126075 CTGATACAGAAGTTGGTGCCAGG - Intergenic
917813477 1:178683865-178683887 CTCAAAAAGCACCTGAGGCCAGG - Intergenic
917813740 1:178686543-178686565 GTCAAAAAGCACTTGAGGCCAGG - Intergenic
917865068 1:179186625-179186647 TTAAGAAAGAAGTTGAGGCCGGG - Intronic
917956876 1:180108497-180108519 CTCAAAAAAAAAGTGGGGCGGGG + Intronic
920398455 1:205662721-205662743 CTGACAGAGAAGTCGGGGCCAGG + Intronic
921224838 1:213008157-213008179 CATAAGAAAAAGTTGGGGCCGGG - Intronic
922434319 1:225588512-225588534 TTGAAAGAAAAGTTGGGGCCGGG + Intronic
923124619 1:231024340-231024362 CACAAAAGGAAGCTGAGGCCTGG + Intronic
923168197 1:231387652-231387674 CTTAAAAATAAGTTGCGGCCGGG - Intronic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
924601614 1:245494740-245494762 CATAAAAAGAAACTGGGGCCAGG + Intronic
1063387340 10:5624316-5624338 CTTGAAAAGAAGTGGGGGCTGGG - Intergenic
1063408677 10:5819741-5819763 CCCAATAGGAAGCTGGGGCCAGG - Intronic
1064149820 10:12853346-12853368 CAAAAAAAAAAGTTGTGGCCAGG - Intergenic
1064269673 10:13853534-13853556 CTGAAAAAAAAGTGGGGGCCAGG + Intronic
1064366367 10:14712294-14712316 TTTAAAAAGAAGTTGGGGCCGGG + Intronic
1064744600 10:18465974-18465996 TTTATAAAGAAGTTGGGGCCGGG - Intronic
1065084483 10:22161103-22161125 TTTAAGAAGAAGTCGGGGCCGGG + Intergenic
1065218902 10:23476049-23476071 TTAAAAAATTAGTTGGGGCCGGG - Intergenic
1065572599 10:27087065-27087087 CTTAATAAGAAGTTTGGGCTGGG - Intronic
1065952471 10:30664743-30664765 ATCAAAAAGAAAATTGGGCCGGG + Intergenic
1067224278 10:44365247-44365269 CTCAAGAAGAGCTAGGGGCCGGG + Intergenic
1067278155 10:44852284-44852306 CCCAAAGACAAGTAGGGGCCTGG + Intergenic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1067879244 10:50029497-50029519 TTCTAAAGGAAGTTTGGGCCAGG + Intergenic
1067892651 10:50149934-50149956 TTCTAAAGGAAGTTTGGGCCAGG - Intergenic
1068530362 10:58179184-58179206 CTTAAAAAAAATTTGAGGCCTGG - Intergenic
1068805321 10:61188676-61188698 CTCAGAAAGGATTTGGAGCCAGG + Intergenic
1069398878 10:68020469-68020491 CTAAAAAAAAAGTTTGGGCCGGG + Intronic
1069521148 10:69123054-69123076 TTTAAAAATAAGTTGAGGCCGGG - Intergenic
1070261334 10:74858571-74858593 CTCAAAAATCATTTTGGGCCAGG - Intronic
1070564171 10:77590905-77590927 CTCAAGAAGAACCTGGAGCCAGG + Intronic
1071679387 10:87689365-87689387 CCCACAAAGAACTTGTGGCCTGG + Intronic
1072165508 10:92809082-92809104 TTCAAAAAGCATTTCGGGCCAGG + Intergenic
1072262558 10:93694418-93694440 ATAAAAAAGAAACTGGGGCCAGG + Intronic
1072528631 10:96297391-96297413 CTTAAAAAAAAATTGAGGCCAGG - Intergenic
1073050965 10:100667139-100667161 ATCAAAATTAAGCTGGGGCCAGG - Intergenic
1073134200 10:101211000-101211022 TTCAAAAAGAAATTGGGGCCAGG - Intergenic
1073241570 10:102062314-102062336 CTAAAAAAACAGTTGTGGCCAGG + Intergenic
1074662831 10:115681807-115681829 CTCAAAAAGAAGTGGTGGGTGGG - Intronic
1075107867 10:119554087-119554109 CTAAAATAGTACTTGGGGCCAGG - Intergenic
1075292521 10:121242571-121242593 GTAAAACAGAAGCTGGGGCCGGG - Intergenic
1075891567 10:125955765-125955787 TTTAAAAATAAGATGGGGCCAGG - Intronic
1077098112 11:808431-808453 GAAAAAAAAAAGTTGGGGCCGGG + Intronic
1077642088 11:3890545-3890567 CTCAAAAGGATATTGTGGCCGGG + Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1082611909 11:55310692-55310714 TTCAAGAAGTAGTTTGGGCCGGG + Intergenic
1083319344 11:61835685-61835707 ATTAAAAAGAAGAGGGGGCCGGG - Intronic
1083996597 11:66276137-66276159 ATCAAAAAGCGGATGGGGCCTGG + Exonic
1084059058 11:66657736-66657758 CTCAAAAAAAAGGTGGGGGAGGG - Intronic
1084100048 11:66941805-66941827 CTTAAAAAGAAATTCCGGCCAGG + Intronic
1084122941 11:67080070-67080092 CTCAAAAAGAAGTAAAGGCTGGG - Intergenic
1084132163 11:67144545-67144567 TTAAAAAAAATGTTGGGGCCGGG - Intronic
1085057735 11:73416943-73416965 CTCAAAAAAAAGGTGGGGGTGGG + Intronic
1085139934 11:74130526-74130548 GAAAAAAAGAAGTTGGGACCAGG - Intronic
1085237066 11:75023461-75023483 CTAAACAAGAGGTTGGGCCCTGG - Intergenic
1086098558 11:83074493-83074515 CTCAAAAAAGAATTAGGGCCAGG + Intergenic
1086146002 11:83552499-83552521 CTCATAAAGAAGTTGGTGAATGG + Intronic
1086230570 11:84564756-84564778 CTCAAAAAGATGTGAGTGCCTGG + Intronic
1086479317 11:87217488-87217510 CTAAAAAGGGATTTGGGGCCGGG + Intronic
1088187153 11:107183497-107183519 ATTAAAAAGAGCTTGGGGCCAGG + Intergenic
1089116890 11:116102642-116102664 CTCACAAGGAACTTGGGACCTGG + Intergenic
1089167366 11:116487492-116487514 ATCCAGAAGAATTTGGGGCCAGG + Intergenic
1089760880 11:120722321-120722343 ATCAGAAAGATTTTGGGGCCGGG + Intronic
1090819431 11:130327821-130327843 ATCAACAAGAAAATGGGGCCGGG - Intergenic
1090948509 11:131452104-131452126 CTCGAAAAGAAGTGGGGGGAGGG + Intronic
1091483537 12:860009-860031 CTCAAAAATAACTTTTGGCCGGG - Intronic
1091854623 12:3729407-3729429 TTTAAAAAGACTTTGGGGCCGGG + Intronic
1092368509 12:7897068-7897090 ATCAAAAAGAATTATGGGCCGGG + Intergenic
1095476679 12:42592863-42592885 TTTAAAAAGAAGTTGCAGCCAGG - Intergenic
1095651588 12:44617390-44617412 ATGAAAAAGCAGTTGTGGCCGGG + Intronic
1095854357 12:46843921-46843943 GACAGAAAGGAGTTGGGGCCTGG + Intergenic
1096206795 12:49729279-49729301 TTAAAAAAAAAATTGGGGCCGGG + Intronic
1096371508 12:51072915-51072937 CTTAAAAATAAATTGGGGGCGGG + Intronic
1096987921 12:55774001-55774023 CTCAAAAAGAAAAAAGGGCCAGG - Intronic
1097685216 12:62684742-62684764 CACAGAAAGAAGGTGGGCCCAGG + Intronic
1099367531 12:81786754-81786776 CACAAAAAGACTTTGGGGCTGGG + Intergenic
1099985036 12:89652332-89652354 CTAAAAAAGGTGGTGGGGCCTGG - Intronic
1100527428 12:95432763-95432785 TTTAAAAAGAAATTGGGGGCTGG + Intergenic
1100648835 12:96562079-96562101 ATCAAAAAGAACTTGTGGTCAGG - Intronic
1101204017 12:102466948-102466970 CTCATAAAGAGGTTGGGGATAGG + Intronic
1101325605 12:103712855-103712877 CTAAAAAAGAATTTGAGCCCTGG + Intronic
1101868451 12:108541831-108541853 CTTAAAAAAAAGTCTGGGCCGGG - Intronic
1101874692 12:108590398-108590420 TTTAAAAAGTAGTTTGGGCCGGG + Exonic
1101936188 12:109059489-109059511 ATAAAAATGAAGTTGGGGCCAGG - Intronic
1102062293 12:109942118-109942140 CTTAAAAGTTAGTTGGGGCCAGG - Intronic
1102696858 12:114806811-114806833 CTGGGAAAGAACTTGGGGCCAGG + Intergenic
1102886547 12:116526263-116526285 TTATAAAAGAAGTTGGGGCCAGG + Intergenic
1102898571 12:116618245-116618267 CTCAGAGAGATGTAGGGGCCTGG - Intergenic
1103075930 12:117982581-117982603 TTTAAACGGAAGTTGGGGCCGGG - Intergenic
1103291135 12:119847277-119847299 ATTAAGAAGAAGTTCGGGCCAGG - Intronic
1103750946 12:123160216-123160238 GAAAAAAAGAAGTTGGGGGCTGG + Intronic
1103789208 12:123457593-123457615 TTTATAAAGAAATTGGGGCCGGG + Intergenic
1103818682 12:123679657-123679679 CTTAAAAAGCTGTTGGGGCAAGG - Intronic
1103921355 12:124400907-124400929 CTCAAAAGGGAGTTGCGGCCAGG + Intronic
1105971691 13:25434642-25434664 CTTGAAAAGAAAGTGGGGCCAGG - Intronic
1107356672 13:39574774-39574796 ATCAAAAAACAGGTGGGGCCAGG + Intronic
1107725030 13:43290729-43290751 CTAAAATAGAAGTTGAGGCTGGG + Intronic
1108679762 13:52769523-52769545 TTTAAAGAAAAGTTGGGGCCAGG - Intergenic
1108737537 13:53300309-53300331 TTCATAAAGTAGTTTGGGCCGGG + Intergenic
1108869230 13:54961888-54961910 CTCAAGAAGAAGCTGGGAGCAGG + Intergenic
1109086695 13:57982525-57982547 GTTAAAAAAAAGTTGAGGCCAGG + Intergenic
1110259029 13:73464546-73464568 CTTAAAAAAAATTAGGGGCCAGG - Intergenic
1110700320 13:78539809-78539831 CTCACAAAGAAGCTTTGGCCTGG + Intergenic
1110902207 13:80837409-80837431 CTCAAAAAAAAGTGGGGGGGTGG - Intergenic
1111457152 13:88499728-88499750 AAAAAAAAGAAGGTGGGGCCGGG + Intergenic
1112176577 13:97031461-97031483 TTAAAAAATAATTTGGGGCCGGG + Intergenic
1112278626 13:98043716-98043738 CTCAAAAGAAAATGGGGGCCAGG - Intergenic
1112870464 13:103964593-103964615 TTAAAAAAGATGATGGGGCCAGG + Intergenic
1113397611 13:109963270-109963292 ATCAGAAAGAAGCTGAGGCCAGG + Intergenic
1114477207 14:23004621-23004643 CTAAAAAACAAATTGAGGCCAGG + Intronic
1115627994 14:35214609-35214631 CCCAAAACAAAGCTGGGGCCGGG + Intronic
1115781724 14:36776535-36776557 CAAAGAAAGCAGTTGGGGCCGGG - Intronic
1117477408 14:56110513-56110535 TTAAAAAAGAAGGAGGGGCCGGG + Intergenic
1117733671 14:58748690-58748712 TTAAAAAAGAAGTTGAGGCCAGG - Intergenic
1117967138 14:61217678-61217700 TACCAGAAGAAGTTGGGGCCAGG + Intronic
1118626051 14:67660287-67660309 CACAAAAAGGAGTCCGGGCCAGG + Intronic
1118628859 14:67684685-67684707 TTTAAAAAGAATTTGAGGCCAGG - Intronic
1119580307 14:75772960-75772982 ATTAAAAAGAATATGGGGCCAGG - Intronic
1119637546 14:76288899-76288921 CTAAAAAAGAATATTGGGCCAGG - Intergenic
1120154890 14:81082651-81082673 GTTAAAAAGAAGCTGGGGACTGG + Intronic
1120175147 14:81285850-81285872 CTAAAATAAAAGTTGAGGCCGGG + Intronic
1120183428 14:81368416-81368438 CTGTAAAAGAGGATGGGGCCAGG + Intronic
1121110917 14:91312385-91312407 CTCAAAAATAAGTAAGGGTCGGG + Intronic
1121141619 14:91547563-91547585 CTCAAAATAAAATTTGGGCCAGG + Intergenic
1121606849 14:95246855-95246877 CTCTATAAGAATTTGGGGGCAGG - Intronic
1121892742 14:97611202-97611224 GTCAAAAATTAGTTGGGACCAGG + Intergenic
1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG + Intergenic
1122474719 14:101999175-101999197 CTCAAAAAAAATTTTTGGCCAGG - Intronic
1122561117 14:102615132-102615154 CTCAAAAAAAGGTGGGGGCGGGG - Intronic
1123508811 15:20973745-20973767 CAGAAAAAGCATTTGGGGCCGGG - Intergenic
1123566035 15:21547494-21547516 CAGAAAAAGCATTTGGGGCCGGG - Intergenic
1123602292 15:21984781-21984803 CAGAAAAAGCATTTGGGGCCGGG - Intergenic
1123999688 15:25745028-25745050 CTTAAAGGGAAATTGGGGCCGGG + Intronic
1124257083 15:28153056-28153078 GTTAAAAAGTCGTTGGGGCCAGG + Intronic
1125588712 15:40841014-40841036 CTAAAATAAAAGTTGAGGCCAGG - Intergenic
1126586101 15:50289034-50289056 CTTAAAAAGAAGTTGGAGCCTGG - Intronic
1126799663 15:52287679-52287701 TTCAAAAGGAAGTTCTGGCCAGG + Intronic
1127611137 15:60638639-60638661 CCCAAAATGAGGTTGGGGACTGG + Intronic
1128203404 15:65829467-65829489 CTACAAAAGTAGTTTGGGCCAGG + Intronic
1129410866 15:75349517-75349539 CTCAAAACTAATTGGGGGCCGGG + Intronic
1129990316 15:79956261-79956283 TTTAAAAAGAAATGGGGGCCAGG - Intergenic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1131006367 15:88982045-88982067 CTCAAGAACAAAGTGGGGCCAGG + Intergenic
1131324184 15:91426701-91426723 CATAAAAAGAAGTCAGGGCCGGG + Intergenic
1131401252 15:92127189-92127211 CTGAACACGAAGTCGGGGCCAGG - Intronic
1132094019 15:98968836-98968858 CTCAGAAAGAACATGGTGCCAGG + Intronic
1132193073 15:99886086-99886108 TTAAAAAAAAAATTGGGGCCAGG + Intergenic
1202974398 15_KI270727v1_random:274587-274609 CAGAAAAAGCATTTGGGGCCGGG - Intergenic
1133004627 16:2872314-2872336 ATCAAAACCAAGCTGGGGCCAGG + Intergenic
1133824246 16:9262912-9262934 CTCAAAAAGAGGGTGGGGGAGGG - Intergenic
1133832337 16:9334703-9334725 ATAAATAAGAAATTGGGGCCAGG - Intergenic
1134163033 16:11907944-11907966 TTCAAAAACAATTTGAGGCCAGG + Intronic
1134289566 16:12892845-12892867 ATCAAAAAGAGATTGAGGCCGGG - Intergenic
1134364141 16:13561160-13561182 TTCAAAAAGATGTTAAGGCCAGG - Intergenic
1134796500 16:17042033-17042055 ATCAAAAAGAAGTCTAGGCCAGG + Intergenic
1135043308 16:19134576-19134598 ACCAAAAAGAAGTTGGAGACTGG - Intronic
1135596407 16:23747352-23747374 CTAAAACAGAAATTGGAGCCAGG + Intergenic
1135690433 16:24533026-24533048 CTAAAAAAAAAAATGGGGCCAGG + Intergenic
1135754659 16:25087045-25087067 TTCAAACAGCAGTTGGGGCCAGG + Intergenic
1136175437 16:28513225-28513247 CCCAAAATGAACTTGGGGCCGGG + Intergenic
1138476421 16:57272954-57272976 CTCAAAAAAAAGTTGGGGGTGGG + Intronic
1138884091 16:61054063-61054085 CTCATTCAGAAGATGGGGCCTGG + Intergenic
1139313185 16:66044284-66044306 CTCATTAAGAAGTTGGCACCTGG - Intergenic
1139399226 16:66667027-66667049 CTAAAATAAAAGTTGGGGCCGGG + Intronic
1139533774 16:67558827-67558849 CTCTTAAAGAAGATGGGGACAGG + Intergenic
1139544045 16:67640732-67640754 ATTAAAAAAAAGTTGGGGCCGGG - Intergenic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1139878184 16:70163241-70163263 CTCAAAAATTACTTTGGGCCAGG - Intergenic
1140300780 16:73755423-73755445 ATCAATAAGTAGATGGGGCCTGG + Intergenic
1140359381 16:74331575-74331597 CTCAAAAATTACCTGGGGCCAGG + Intergenic
1140394988 16:74618726-74618748 TTCAAGAAGAAGCTGGGGCTGGG + Intergenic
1140616254 16:76668055-76668077 TTCAAAATGAAGATGAGGCCGGG + Intergenic
1140886509 16:79249122-79249144 TTATAAAAGAAGTTGAGGCCGGG + Intergenic
1140938657 16:79700070-79700092 CTCAAAAAGTAATTTGTGCCAGG - Intergenic
1142454056 16:90205877-90205899 GTCAAAAAGAAATTCAGGCCGGG - Intergenic
1142731774 17:1863506-1863528 TATAAAAAGTAGTTGGGGCCAGG - Intronic
1142995320 17:3756698-3756720 AACAAAAAGTAGCTGGGGCCAGG - Intronic
1143078046 17:4362010-4362032 CACAAAAAGAACTTATGGCCAGG + Intronic
1143268898 17:5661215-5661237 TTAAAAAATAAGTGGGGGCCAGG - Intergenic
1144612647 17:16736920-16736942 CTCAAAAAGAATTTGGTACGTGG - Intronic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1145923320 17:28627692-28627714 CAAAAAAAGAATATGGGGCCGGG - Intronic
1146027861 17:29338334-29338356 CTTAAAAATAAGTATGGGCCAGG + Intergenic
1146509818 17:33437158-33437180 TCTCAAAAGAAGTTGGGGCCGGG - Intronic
1148006922 17:44440075-44440097 TTTTAAAAGAAGTTGAGGCCGGG - Intronic
1148371186 17:47100888-47100910 TTCAAGAAGAAATTTGGGCCGGG + Intergenic
1148487281 17:47998667-47998689 TTTAAAAAGAAGTGTGGGCCAGG - Intergenic
1148549421 17:48541823-48541845 CTCAAAATGGCGCTGGGGCCGGG - Intronic
1148602736 17:48906809-48906831 TTAAAAAAGAAGTCTGGGCCGGG - Intergenic
1148661208 17:49334481-49334503 CTCAAAAAGAAGAAATGGCCGGG + Intronic
1148818636 17:50347447-50347469 CTCCAAAAGGAGGTGGGGGCGGG + Intronic
1148931640 17:51131883-51131905 TTAAGAAAGAACTTGGGGCCGGG + Intergenic
1149603423 17:57908055-57908077 CTCAAAAAGAACCTGATGCCTGG - Intronic
1150141412 17:62732695-62732717 TCCAAAAAGAAGATGGGGCCGGG + Intronic
1150365068 17:64575446-64575468 TTTAAAAAGTAGTGGGGGCCGGG - Intronic
1150686656 17:67326500-67326522 ATCAGAAACAAGATGGGGCCGGG - Intergenic
1150689855 17:67355829-67355851 CTCAAAAATAAGTTGGAAGCCGG + Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151085898 17:71380312-71380334 GTCAAAAAGAGGTTGGGGAAAGG - Intergenic
1151610758 17:75172914-75172936 CTCAAAAGGAATTACGGGCCAGG - Intergenic
1151723576 17:75872309-75872331 ATAAAAAAAAAATTGGGGCCAGG - Intergenic
1151756047 17:76075879-76075901 ATCCAAAACAAGTCGGGGCCGGG + Intronic
1151803277 17:76390306-76390328 CTCTAAGAGAGGTTGGGACCAGG - Exonic
1151936305 17:77263840-77263862 CTCAAAAAAAAATTCAGGCCAGG + Intergenic
1152107770 17:78341137-78341159 CTAGAAAGGAAGTGGGGGCCGGG + Intergenic
1152156441 17:78636767-78636789 CTCAAAAAGAATGAGGGGGCTGG + Intergenic
1152247878 17:79195098-79195120 CTCAAGAAGAAGTGCAGGCCGGG + Intronic
1152653486 17:81508150-81508172 ATAAAAAAAAAATTGGGGCCAGG + Intergenic
1156383347 18:36583648-36583670 CTCACAAAGAAGCTGGGGGCAGG - Intronic
1157488876 18:48108431-48108453 CTCAAAAACAAGGTAGGGGCAGG - Intronic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158056787 18:53290871-53290893 TTTAAAAAAATGTTGGGGCCAGG + Intronic
1158581960 18:58691573-58691595 ATAAAAAAGAAGGTGGGACCGGG + Intronic
1158657369 18:59350788-59350810 TTTAAAAAAAAATTGGGGCCGGG - Intronic
1158733714 18:60055481-60055503 CTCAAAAGGATGGTGGGGCCGGG + Intergenic
1159173117 18:64798594-64798616 ATGAAAAGGAATTTGGGGCCAGG + Intergenic
1159725424 18:71951966-71951988 CTCAGGAAAAAGTTGGGCCCAGG + Intergenic
1160702007 19:512164-512186 CTCAAAAAGAAAACTGGGCCAGG - Intronic
1160913367 19:1485215-1485237 CTCAAAAAGAACTAAGAGCCTGG + Intronic
1160958606 19:1706842-1706864 CTCAAAAAGCAGAGGGGGGCCGG + Intergenic
1161085616 19:2333607-2333629 CTCAAAATGAAGTAGGGGGCAGG - Intronic
1161392807 19:4030115-4030137 TTAAAAAATTAGTTGGGGCCGGG - Intronic
1161536182 19:4820123-4820145 TTTAAAAAAAAGTTTGGGCCAGG + Intronic
1161634245 19:5377258-5377280 TGCAAAAAGGACTTGGGGCCGGG + Intergenic
1161943012 19:7417709-7417731 ATGAAAAAGAAGATGGGGACAGG + Intronic
1161957225 19:7503065-7503087 TCCAAGAAGAAGTTGCGGCCGGG + Intronic
1162564889 19:11440445-11440467 CTCAAAAAAAAGTGTGGGCCAGG - Intronic
1162694583 19:12463630-12463652 TTCAAAAGGAAATGGGGGCCGGG + Exonic
1162906554 19:13827307-13827329 AGAAAAAAGAAGTTGGGGCCAGG + Intronic
1162945544 19:14041196-14041218 CTCAAAAAAAAAAGGGGGCCGGG - Intronic
1163288226 19:16362803-16362825 CTAAAAAAGAACTTAAGGCCAGG - Intronic
1163745000 19:19041128-19041150 CACGAAAAGGAGCTGGGGCCAGG - Intronic
1163964010 19:20726532-20726554 CTCAGAAAGAAGTTTTGGCCTGG - Intronic
1163996962 19:21059247-21059269 ATAAAACTGAAGTTGGGGCCAGG + Exonic
1164268352 19:23643680-23643702 GTCAAAAATAAGTTGGGGGAAGG + Intronic
1164779955 19:30884262-30884284 TTTAAAAAGAAGTGGGGGCCAGG - Intergenic
1165024569 19:32950261-32950283 CTTAAAAAGCATTAGGGGCCAGG + Intronic
1165206002 19:34186942-34186964 GTCAAAAAAAAGTTCAGGCCGGG + Intronic
1165612451 19:37167459-37167481 ATTAAAAAGCATTTGGGGCCAGG - Intronic
1166309141 19:41952577-41952599 CTCAAAAAGAAGGCGGGGGCGGG - Intergenic
1166612938 19:44215690-44215712 ATCTGAAAGAAGATGGGGCCAGG + Intronic
1166640593 19:44491871-44491893 TTCAAAAAAAAGTTTAGGCCAGG - Intronic
1166717513 19:44977817-44977839 CTCAAAAATAATTTGTGGGCTGG + Intronic
1167431234 19:49455599-49455621 AAAAAAAAGAAGTTGAGGCCAGG + Intronic
925634574 2:5930659-5930681 ACCAATAAAAAGTTGGGGCCAGG + Intergenic
926296134 2:11570111-11570133 CTCTAAAAGATAATGGGGCCAGG + Intronic
926627818 2:15107855-15107877 ATCAATAATAACTTGGGGCCAGG - Intergenic
927209652 2:20631211-20631233 CTTAAAAAGCAAATGGGGCCAGG + Intronic
927652819 2:24922549-24922571 CTCAAAAAAAAGTGGGGGTTGGG + Intergenic
928049085 2:27969663-27969685 CTCAAACTGAGGTTGGGGCTCGG + Intronic
928155279 2:28870783-28870805 ATCAAAAGGGAGTTGGGGCTGGG - Intergenic
928985679 2:37179251-37179273 TTAAAAACGAATTTGGGGCCAGG - Intronic
929190191 2:39132759-39132781 TTCAAAACAAAGCTGGGGCCGGG + Intergenic
929490921 2:42395404-42395426 TTTAAGAAGGAGTTGGGGCCAGG + Intronic
929692140 2:44083828-44083850 TTTAAAAAAAAGTTAGGGCCGGG + Intergenic
929710116 2:44258069-44258091 GTTAAAAAAAACTTGGGGCCAGG + Intergenic
930053859 2:47237240-47237262 CTCAAAAATGAGCTGGGGCCGGG + Intergenic
930510180 2:52334909-52334931 CTCTAAAAGAAATTGGTCCCTGG + Intergenic
931539462 2:63314170-63314192 AAAAAAAAGAAGATGGGGCCAGG - Intronic
932003865 2:67908606-67908628 TTTAAAAAAATGTTGGGGCCAGG + Intergenic
932257180 2:70297958-70297980 CTCAAACAGAAGATGGCACCAGG + Intronic
932597688 2:73104280-73104302 CTCAAAAGTAAATAGGGGCCAGG + Intronic
933157422 2:78991638-78991660 TTGAAAAAGAAGTTCAGGCCAGG - Intergenic
933757734 2:85653312-85653334 CTCAAGAACAAGCAGGGGCCAGG - Intergenic
933929509 2:87134466-87134488 CTCAAAAATAACTTCAGGCCGGG - Intergenic
934000840 2:87710258-87710280 CTCAAAAATAACTTCAGGCCGGG - Intergenic
934559398 2:95304834-95304856 CTTAGAAGGAAGTTGAGGCCTGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
934893175 2:98088210-98088232 CTGAAAAAGAAGTCTGGGCTAGG - Intronic
935245491 2:101215678-101215700 TTCAAAAATTAGTTGGGGCCAGG + Intronic
935684219 2:105669423-105669445 ATAAAAAAGAACTTGAGGCCAGG - Intergenic
936051093 2:109224107-109224129 CACAAAAAGAAACTGAGGCCTGG + Intronic
936363424 2:111828917-111828939 CTCAAAAATAATTTCAGGCCGGG + Intronic
938342283 2:130543790-130543812 CTCAGGAAGAAGTCGGGGCTGGG + Intronic
938347549 2:130576919-130576941 CTCAGGAAGAAGTCGGGGCTGGG - Exonic
938807183 2:134817263-134817285 AAAAAAAAGGAGTTGGGGCCGGG + Intergenic
939397485 2:141649882-141649904 TTTAAAAACCAGTTGGGGCCAGG + Intronic
939685188 2:145190269-145190291 CTCAAAAAGATCTGTGGGCCTGG + Intergenic
940621004 2:156113642-156113664 AACAATAAAAAGTTGGGGCCGGG - Intergenic
941047520 2:160693384-160693406 CTGAAAAAGTATTTGAGGCCGGG - Intergenic
942502868 2:176610146-176610168 TTAAAAAAAAGGTTGGGGCCCGG - Intergenic
942586366 2:177483532-177483554 TTCAAAAGGAAGTAGGGTCCTGG + Intronic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943715995 2:191152295-191152317 CTCAACAAGCAGTGGGGACCAGG - Intergenic
943924859 2:193761953-193761975 CTAAAGAAGAAATTGGAGCCAGG - Intergenic
944150575 2:196554041-196554063 CTTAAAAAGATTTTTGGGCCGGG + Intronic
944302549 2:198140146-198140168 TTAAAAAAGAAGTATGGGCCAGG - Intronic
944464500 2:199986870-199986892 CTCAAAAATGAGTTAGGGCTTGG - Intronic
945880842 2:215323238-215323260 AAAAAAACGAAGTTGGGGCCGGG - Intronic
946769146 2:223070404-223070426 CTCATAAAAAAGTTGGGGAGGGG - Intronic
947768674 2:232653909-232653931 CATTTAAAGAAGTTGGGGCCAGG + Intronic
948566615 2:238891398-238891420 CTCAAAAGGAACCTGGGGCTTGG + Intronic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
949085509 2:242150539-242150561 GTCAAAAAGAAATTCAGGCCGGG - Intergenic
1169148223 20:3268328-3268350 CTCAAAAAAAAAAAGGGGCCGGG - Intronic
1169308836 20:4517980-4518002 CATAAAAAGAAGTTAGGGGCCGG - Intergenic
1170286354 20:14714095-14714117 CTCAAAAATAGGTTGGGCTCAGG + Intronic
1170532278 20:17306421-17306443 CTCAAACAGAAGATGGTCCCAGG + Intronic
1171108814 20:22461738-22461760 AACAAATAGAAGTTGGAGCCTGG - Intergenic
1171223864 20:23424275-23424297 ATAAACAAGAGGTTGGGGCCAGG - Intergenic
1172085014 20:32374588-32374610 TTCAAAAAGAATAAGGGGCCGGG - Intronic
1172710437 20:36918501-36918523 CTAAAAAAGAATTTATGGCCGGG + Intronic
1173143903 20:40508635-40508657 CTCAAAAATGAGTAGGGGCTGGG - Intergenic
1173573272 20:44092356-44092378 CTCAAAACTAACTGGGGGCCGGG + Intergenic
1174068169 20:47880496-47880518 ATTAAAAAGTAGTTTGGGCCAGG - Intergenic
1174118004 20:48241175-48241197 TTAGAAAGGAAGTTGGGGCCAGG - Intergenic
1174232689 20:49059582-49059604 CTTCAAAAGATTTTGGGGCCGGG + Intronic
1174357499 20:50008483-50008505 CTCAAAAAGACCTTCTGGCCAGG + Intergenic
1175143641 20:56879686-56879708 CTAGAAAAGAACTGGGGGCCGGG + Intergenic
1175574747 20:60052427-60052449 CACAATAGGAAGTTGGGGCGGGG + Intergenic
1176108347 20:63399875-63399897 CCCAGAAAGATGCTGGGGCCTGG - Intergenic
1176661992 21:9645699-9645721 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1177518313 21:22183803-22183825 CTCAGAAATAACTTGTGGCCGGG + Intergenic
1177598183 21:23274605-23274627 TTAAAAAAAAAATTGGGGCCAGG + Intergenic
1177856837 21:26408920-26408942 TTTAAAAGGAAGTTGGGGCTGGG + Intergenic
1178356443 21:31913562-31913584 CCCAGAGAGGAGTTGGGGCCGGG + Intronic
1178450099 21:32690593-32690615 ATTAAAAAAAAGTTGCGGCCAGG + Intronic
1179051995 21:37896273-37896295 CTAATAATGGAGTTGGGGCCTGG - Intronic
1179507322 21:41850436-41850458 CTCAAGAACAAGTTAAGGCCAGG + Intronic
1179515109 21:41900799-41900821 GTCAAAAAAAAGTAAGGGCCGGG + Intronic
1179571138 21:42279542-42279564 CCCAAAAGGCAGGTGGGGCCTGG - Intronic
1180035048 21:45242933-45242955 CTCAAAAAGAAATAACGGCCAGG + Intergenic
1180366349 22:11942677-11942699 CATTAAGAGAAGTTGGGGCCAGG + Intergenic
1181767798 22:25104272-25104294 TTAATAAAGAAGGTGGGGCCAGG - Intronic
1182137274 22:27918526-27918548 CTAAGAAAGTAGGTGGGGCCCGG + Intronic
1182472607 22:30557613-30557635 CTCAAAGAGAGGTTGGGGAATGG + Intronic
1183063448 22:35348937-35348959 CTCAAGATGGAGTTGGGGCAAGG + Intergenic
1184546356 22:45171475-45171497 CTCAAAAATAAATTTTGGCCAGG - Intronic
1184704434 22:46200921-46200943 CTCAAAAAAAAGTTGGGGCGTGG + Intronic
1185302297 22:50088286-50088308 ATCAAAAATAAGTCGGGGCTGGG + Intergenic
949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG + Intronic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950885666 3:16360439-16360461 ATAAAAAAGAAGTTGAGGCCTGG - Intronic
951245979 3:20342036-20342058 TTCAAAAAAAATTTGGGGCTGGG - Intergenic
951323020 3:21270633-21270655 GGCAAAGAGAAGTTGGAGCCCGG - Intergenic
951501912 3:23398015-23398037 CTCAAAAGAAACTTGGGGCCAGG + Intronic
952025230 3:29072481-29072503 CTAAAATAGAAGTTAGGTCCAGG - Intergenic
953320723 3:41968852-41968874 CTAAAAAAGAAATTTAGGCCAGG - Intergenic
954127741 3:48541668-48541690 CAAAAAAAGAAATTTGGGCCGGG + Intronic
954176488 3:48849332-48849354 CTCAAAAAAAAATAGGGGCCTGG - Intergenic
954477677 3:50763576-50763598 CTCAAGAAGAAATAGAGGCCAGG - Intronic
954574368 3:51667457-51667479 ATCAAAAGGAAGTGGGGGCCAGG - Exonic
955205389 3:56891311-56891333 CTAAAAATGGAGTAGGGGCCAGG - Intronic
957740782 3:84265663-84265685 CTCCCAAAGAATTTGGGGACTGG + Intergenic
958493940 3:94818005-94818027 AACAATATGAAGTTGGGGCCAGG + Intergenic
958606067 3:96360174-96360196 CTTAAAAAAATGTTGGGGCTAGG + Intergenic
959710814 3:109384137-109384159 CTGGAGCAGAAGTTGGGGCCAGG + Intergenic
959932120 3:111996526-111996548 CTTAAAAAGTTGTTGAGGCCAGG + Intergenic
960135455 3:114099673-114099695 CTCAAAAATCAATTGAGGCCAGG + Intergenic
960582825 3:119295028-119295050 AACAAAAAGAAGGTGGGGGCGGG - Intronic
961025803 3:123556139-123556161 CTAAAAAATAAATTGAGGCCGGG + Intronic
961354190 3:126324574-126324596 ATTAAAAAAAAGTTGGGGGCGGG - Intergenic
962230979 3:133665168-133665190 TTAAAAAAGAAGCTGGGGACCGG + Intergenic
962504307 3:136030215-136030237 CTCAATAAAAAGTTGGGGCGGGG + Intronic
962651691 3:137500123-137500145 TTCAAAGAGGAATTGGGGCCAGG - Intergenic
963120531 3:141772835-141772857 CTAAAATAAAAGTTGAGGCCGGG + Intergenic
963153349 3:142070200-142070222 GAAAAAAAGAAGTTTGGGCCAGG - Intronic
963778824 3:149466320-149466342 CTCTCAAAGGAGTTGGGGCGAGG + Intergenic
965534490 3:169811159-169811181 CCCAAATAGAAGTTGGAGCTGGG + Intronic
965546186 3:169918849-169918871 CAAGAAAGGAAGTTGGGGCCAGG + Intronic
965647878 3:170902898-170902920 TACAAAAAGAAGCTGAGGCCGGG - Intronic
966189465 3:177259000-177259022 CTGCAAAAGAAGTTGGCACCCGG - Intergenic
966332871 3:178834643-178834665 CTAAAAAAAAAGTGGGGGCGTGG + Intronic
966774992 3:183536067-183536089 CCAAACAAGAATTTGGGGCCAGG - Intronic
966838737 3:184070204-184070226 CTCAATAAAAAAATGGGGCCAGG - Intergenic
966941018 3:184747106-184747128 TTTAAAAAGAAGATGAGGCCGGG + Intergenic
966997078 3:185293404-185293426 CTCAAAAAGAAAAAGAGGCCAGG - Intronic
968122770 3:196137447-196137469 GCCATAAAGAATTTGGGGCCGGG - Intergenic
969038978 4:4279027-4279049 CTAAAAAAGAAGGCTGGGCCAGG + Intronic
969097989 4:4748549-4748571 ATCAAAAAGGATTTGAGGCCAGG + Intergenic
969631167 4:8337965-8337987 CTTAGAAAAAAGTTGCGGCCGGG - Intergenic
969933307 4:10655128-10655150 CTCAAAAAGATGTTAAGGTCTGG + Intronic
970600415 4:17637320-17637342 CTGAAAAAGCAGTGGGGGCCGGG - Intronic
972441536 4:39098560-39098582 CAAAAAAAAAAGTTGTGGCCCGG - Intronic
972476532 4:39455533-39455555 CTTAAAAATTAGCTGGGGCCAGG + Intronic
972581607 4:40400121-40400143 CTCCAGAAGGAGTTGGGGCGAGG + Intergenic
972672900 4:41231051-41231073 ATCAAAAATTATTTGGGGCCAGG + Intergenic
973225992 4:47785615-47785637 CTCAAAAGGAAATAGGGGGCTGG + Intronic
973884461 4:55306533-55306555 TTCAACAAGAATTTGGGGCCAGG - Intergenic
974038280 4:56836247-56836269 CCAAAAATGAAGATGGGGCCAGG + Intergenic
974194091 4:58548422-58548444 CTCAGAAAGGAGTTAGGGCTGGG + Intergenic
976193219 4:82508759-82508781 ATAAAAAAGAAGTACGGGCCAGG - Intronic
977741208 4:100485691-100485713 ATCAAAAAGAAGTTGGTGCCAGG - Intronic
977868441 4:102059601-102059623 CACAAAAGGAATTTGTGGCCTGG - Intronic
977934527 4:102785998-102786020 TTCAAAAAGTAATTGGGGCCAGG - Intergenic
979544719 4:121926700-121926722 CTCTAAAAGAAAATGAGGCCGGG - Intronic
980027056 4:127780506-127780528 GTAAAAAGGAAGTTGAGGCCAGG - Intergenic
980070083 4:128234667-128234689 CTCAAAAAACATTTAGGGCCAGG - Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
981761327 4:148198783-148198805 CTTAAAAAAAAAATGGGGCCAGG + Intronic
981968902 4:150640150-150640172 ATTAAAAATAAATTGGGGCCGGG - Intronic
982144021 4:152362513-152362535 TTAAAAAAGAACTTAGGGCCGGG + Intronic
982470736 4:155786900-155786922 TTAAAAAAGAAATTGAGGCCAGG - Intronic
983622664 4:169776372-169776394 AAGAAAATGAAGTTGGGGCCAGG + Intergenic
984267924 4:177516329-177516351 CTAAAAAATTAGTTGGGGCTGGG + Intergenic
984342236 4:178471872-178471894 CTCAAAAAAATATTTGGGCCAGG + Intergenic
984922372 4:184777170-184777192 CTTAAAAAGAAATTAAGGCCAGG + Intronic
985358767 4:189149264-189149286 TTAAAAAAGAATTTTGGGCCAGG + Intergenic
985413403 4:189710847-189710869 CTCAAAAATTAGTTGGGCCATGG + Intergenic
985930650 5:3054750-3054772 AAAAAAAATAAGTTGGGGCCAGG - Intergenic
986927202 5:12769658-12769680 TTATAAAAGAAGATGGGGCCGGG + Intergenic
987358479 5:17085387-17085409 TTAAAAAATAAGATGGGGCCAGG + Intronic
987904667 5:24060448-24060470 CATAAAAAGAACCTGGGGCCGGG + Intronic
988367090 5:30314259-30314281 ATTAAAAAGAAATAGGGGCCAGG - Intergenic
989605717 5:43242530-43242552 CTCCACAAGAAGATGGGGCCAGG + Intronic
990040145 5:51369812-51369834 AAAAAAAAGAAGTTGAGGCCAGG - Intergenic
990219616 5:53573268-53573290 TTCAAAAAGAAGGATGGGCCAGG - Intronic
990257655 5:53987805-53987827 TTAAAAAATAATTTGGGGCCAGG + Intronic
990726188 5:58757448-58757470 ATTAAAAAAAAGTTGGGGGCGGG - Intronic
991206568 5:64056572-64056594 GTCAAAAAAAAGTTTTGGCCTGG + Intergenic
991365301 5:65861512-65861534 ATCAAAAAGAACTCGAGGCCTGG - Intronic
991578847 5:68133226-68133248 TTGAAAAAGACATTGGGGCCGGG - Intergenic
991909166 5:71544582-71544604 TTGAAAAAGAAGTTCTGGCCGGG + Intronic
995102908 5:108336965-108336987 CTCAAAGAGAATTTTTGGCCAGG + Intronic
995207222 5:109494684-109494706 CTCAAAAAAAAGTTGGGGAGAGG - Intergenic
995782031 5:115787328-115787350 CTCAACAAGAATTTGGGGGGGGG - Intergenic
996619093 5:125478453-125478475 CAGAAAGAGAAGCTGGGGCCAGG - Intergenic
997757154 5:136409993-136410015 CTCAAAAAGAGGGTGGGACCAGG + Intergenic
998063763 5:139139831-139139853 TACAAAAACTAGTTGGGGCCGGG + Intronic
998319774 5:141218236-141218258 TTCAAGAAGTAGTTGAGGCCAGG - Exonic
998960384 5:147480221-147480243 CGCAAAAAGAAGCTGGAGGCCGG - Intronic
999174892 5:149625198-149625220 TTTAAAAAGCATTTGGGGCCAGG - Intronic
999375272 5:151082066-151082088 CTCAAAAAGAATTAGGGGAAAGG + Intronic
1000124132 5:158226915-158226937 CGCCAAAAGAAGCTAGGGCCTGG - Intergenic
1000815258 5:165913404-165913426 TTCAAAATGAAGTTGGGACTAGG + Intergenic
1000869097 5:166553013-166553035 AAAAAAAAGAAGTTGTGGCCAGG - Intergenic
1001226951 5:169953026-169953048 TTAAAAGAGAATTTGGGGCCAGG + Intronic
1001581382 5:172800848-172800870 CTCAAAAGGCAGTGAGGGCCAGG + Intergenic
1002178569 5:177417276-177417298 CTAAAGAGGAAGTGGGGGCCGGG - Intronic
1002201603 5:177531750-177531772 CAGAAAAACAAGTTGGAGCCCGG + Intronic
1002344819 5:178541290-178541312 TTCAAAAATGATTTGGGGCCGGG + Intronic
1004079696 6:12380173-12380195 ATCAAAAGGAAGCTGGGGCCAGG + Intergenic
1005625843 6:27661667-27661689 CTCAAAATGAAGTTAGGGAAGGG + Intergenic
1006087021 6:31603242-31603264 TTTAAAAAGAAAGTGGGGCCAGG - Intergenic
1006452382 6:34112644-34112666 CCCACCAAGAAGTTGGGGCCAGG - Intronic
1006482372 6:34307281-34307303 CTTTAAAAAAAGTTGAGGCCAGG + Intronic
1006780184 6:36627315-36627337 CTCAAAAAGAAATGTGGGCCAGG - Intergenic
1008007881 6:46431363-46431385 TTTAAAAGCAAGTTGGGGCCAGG - Intronic
1009763186 6:68035672-68035694 CTCAAAAAGTACTTAGGGCCGGG + Intergenic
1010139240 6:72594637-72594659 CTAAAATATAAGTTGAGGCCAGG - Intergenic
1010709714 6:79159651-79159673 CTCAAAAATAAATTGGTACCTGG - Intergenic
1010720669 6:79279957-79279979 ATCAAAAAGAGGTTAGTGCCTGG + Intergenic
1011052680 6:83171042-83171064 TTCAAAATAATGTTGGGGCCAGG + Intronic
1011690700 6:89865122-89865144 CTTAAAAAGTGCTTGGGGCCAGG - Intronic
1011819006 6:91228514-91228536 TTAAAAAAGAAGTTGATGCCAGG + Intergenic
1013005939 6:106073408-106073430 ATCAAAAGGAAATTGAGGCCGGG - Intergenic
1013430247 6:110049070-110049092 CTCAAAAGGAAGTTGAGTCGGGG + Intergenic
1013507838 6:110816881-110816903 CTCAAAAAGGAAGTGGGGCCCGG - Intronic
1014468760 6:121788417-121788439 CACAAAAAGAACTTAAGGCCAGG + Intergenic
1015274116 6:131366944-131366966 CTTAAAAAAAAGTTGAGGCCGGG + Intergenic
1016744040 6:147559004-147559026 CACAACAAGAAGTGGGGGCTAGG - Intronic
1017166448 6:151412450-151412472 GTTAAAAACAAGTTAGGGCCAGG - Intronic
1017469484 6:154725388-154725410 CTCAAAAAGAAATCCAGGCCAGG + Intergenic
1017808207 6:157964683-157964705 CTCAAAAATAAAATGAGGCCGGG + Intergenic
1019391512 7:789895-789917 CTCAAAAAGCTGTTGTTGCCAGG + Intergenic
1019745547 7:2698542-2698564 AACAAAAAGAAGTTGGGGCTCGG + Intronic
1020283389 7:6663236-6663258 CTCAAAAAAAAGGTTGGGGCAGG - Intergenic
1020505848 7:8987039-8987061 CTCAAAAGGGAGTTGGGGTTAGG - Intergenic
1020951892 7:14689464-14689486 CTAAAAGAGAAGTTTCGGCCGGG - Intronic
1023486816 7:40696396-40696418 CCCAAACATAAGATGGGGCCTGG - Intronic
1024267746 7:47619730-47619752 TTCAAAATGAATTTGGGGGCTGG - Intergenic
1025264775 7:57447503-57447525 CAAAAAAAGAATTTAGGGCCGGG + Intergenic
1025919177 7:65894447-65894469 CTTAGAAATAAATTGGGGCCGGG + Intronic
1026900737 7:74035993-74036015 CTTAAAAAGTATTTGAGGCCAGG + Intronic
1027237408 7:76306259-76306281 CTAAAAAAGAAGCTGGGGCCGGG - Intergenic
1027872823 7:83731635-83731657 AAAGAAAAGAAGTTGGGGCCGGG + Intergenic
1028177935 7:87679387-87679409 CTTAAAAAAAAGTTGGGGGCCGG - Intronic
1028904374 7:96136626-96136648 CTGATAAAGAAGTCAGGGCCAGG + Intronic
1029220640 7:98986987-98987009 ATCAAAAATCAGTTGAGGCCAGG + Intronic
1030120344 7:106104246-106104268 CTAAAAAATAAAATGGGGCCGGG + Intronic
1030300560 7:107970189-107970211 TTCAAAAAAGAGGTGGGGCCAGG + Intronic
1030935448 7:115580389-115580411 ATAAGAAAGAGGTTGGGGCCGGG + Intergenic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1031977507 7:128103503-128103525 TTTAAAAAGAACTAGGGGCCGGG - Intergenic
1032048673 7:128632088-128632110 CAAAAAATGTAGTTGGGGCCAGG + Intergenic
1032360669 7:131251972-131251994 CCTAAAATGAAGTTGGGGCTGGG - Intronic
1032363098 7:131274158-131274180 CTGAAACATAAGTTGGGGACGGG + Intronic
1032404605 7:131646949-131646971 CTCAAAAAAAAGGCCGGGCCTGG - Intergenic
1032564307 7:132925835-132925857 CTCAAAAACGAGTTGGGGATGGG + Intronic
1032861349 7:135882918-135882940 CTAAAATAAAAGTTGAGGCCAGG + Intergenic
1033148888 7:138895977-138895999 GTGAAAGAGAAGTGGGGGCCGGG - Intronic
1033178712 7:139152851-139152873 CTCAAAAAGAAATGTTGGCCAGG + Intronic
1033608618 7:142944931-142944953 CACAAAGGGAAGGTGGGGCCTGG + Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1035202179 7:157274746-157274768 CGTAAAAAGAAGTGTGGGCCAGG + Intergenic
1035523925 8:296983-297005 AGCAAAAAGAAGGTGGGGCCAGG + Intergenic
1035939472 8:3881338-3881360 ATAAAAAGCAAGTTGGGGCCGGG + Intronic
1036538447 8:9676306-9676328 CTAAAAAAGAATTCTGGGCCAGG - Intronic
1037396339 8:18447784-18447806 CTAAAAAAGTAGATAGGGCCAGG - Intergenic
1038245109 8:25848157-25848179 CTTTAAAAGAAGAAGGGGCCAGG - Intronic
1038705140 8:29886427-29886449 TTCAAAAAGAACCTGGGGCTGGG + Intergenic
1038823089 8:30971239-30971261 TTTAAAAACAAGATGGGGCCGGG + Intergenic
1039234117 8:35483096-35483118 CTTAAAAAAAAAATGGGGCCAGG - Intronic
1039452751 8:37688737-37688759 TTAAAAAAGAAGTGGGGGTCAGG + Intergenic
1039568867 8:38570684-38570706 CTCAAAAAAAAAATGGGACCGGG + Intergenic
1039876934 8:41594838-41594860 TTAAAAAAAAAGTTTGGGCCGGG - Intronic
1040460561 8:47643659-47643681 CTAAAATAGAAGTTGCGGTCAGG - Intronic
1040493675 8:47947611-47947633 TACAAAAATTAGTTGGGGCCGGG + Intronic
1040692149 8:49952033-49952055 CTCAAGAAGATTTTGGAGCCTGG + Intronic
1040871413 8:52103457-52103479 TTCAAAAAAATGTTGGGGCCAGG + Intergenic
1041343811 8:56874334-56874356 CTGAAAAACAAGATGGGACCTGG - Intergenic
1041736217 8:61113599-61113621 CTGAAAAACAAGTTGGACCCAGG + Intronic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1043425907 8:80148456-80148478 CTTAAAAACAATTTAGGGCCAGG - Intronic
1043673650 8:82921465-82921487 CTCTATAAGAATCTGGGGCCTGG - Intergenic
1044103733 8:88175047-88175069 CTCAAAAAGCAGTCAAGGCCAGG - Intronic
1044700697 8:94963088-94963110 CACGAAAAGGAGTTTGGGCCAGG - Intronic
1044862354 8:96535300-96535322 CTAAAAAATTATTTGGGGCCGGG - Intronic
1044924512 8:97198794-97198816 CTCAAAAAAAAAATTGGGCCAGG + Intergenic
1045210328 8:100091171-100091193 TTCAAAAAGAATCTGGGGACAGG - Intronic
1047205522 8:122800149-122800171 CTCAAAAATAAATTTAGGCCAGG - Intronic
1047449042 8:124946226-124946248 CTCAAATAGAAGGTGGGGTCAGG + Intergenic
1047482995 8:125302250-125302272 TTAAAAAAGAAATTGGGACCTGG - Intronic
1047924261 8:129667323-129667345 ATCAAAAAGAATTCAGGGCCAGG + Intergenic
1047953276 8:129953362-129953384 CTCAAGTACAAGTTGGGACCAGG - Intronic
1049732655 8:144186415-144186437 CACAAAAATAATTTGGGGCCGGG - Intronic
1049831933 8:144706167-144706189 CTCAGAGGGAAGGTGGGGCCAGG - Intergenic
1051663676 9:19448307-19448329 TTAAAAAAAAAGTTTGGGCCAGG - Intronic
1052207944 9:25866000-25866022 TTCAAAATGAAGATAGGGCCAGG - Intergenic
1052417733 9:28199631-28199653 CTAAAAATGAAGAAGGGGCCAGG - Intronic
1052891173 9:33701590-33701612 CTTAAAAAAAAATTGGGGCCAGG + Intergenic
1053030412 9:34771897-34771919 CTCAAAATGAGGATGGGGACAGG - Intergenic
1053325081 9:37136918-37136940 TTCAAAAGCAACTTGGGGCCAGG - Intronic
1053379504 9:37636767-37636789 ATCAAAAAGCAGATGGGGCCCGG - Intronic
1054971701 9:71095461-71095483 CTCTTAAAGAATTTGAGGCCAGG + Intronic
1055635840 9:78278440-78278462 CACACAAGGAAGGTGGGGCCAGG - Intronic
1057196323 9:93117343-93117365 CTCAAAAAAAAAAAGGGGCCGGG - Intergenic
1057525452 9:95795640-95795662 CTTAAAAAGAAGTTGAGGCTGGG + Intergenic
1057736782 9:97669921-97669943 CTCAAAAAAAAGGTGGGGCGGGG - Intronic
1057912828 9:99033604-99033626 CTCAAAAATAAGATGGGGAGTGG - Intronic
1058436987 9:104971982-104972004 CTTAAAAACAAGTTTGGGCCAGG + Intergenic
1058566862 9:106295300-106295322 CTGGAACAGAAGCTGGGGCCTGG - Intergenic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1058834628 9:108850032-108850054 CTTAGAAAGACCTTGGGGCCAGG + Intergenic
1060330052 9:122659869-122659891 CAAAAAAAGTGGTTGGGGCCGGG - Intergenic
1060655763 9:125371668-125371690 GTTAAAAAGAAGCTTGGGCCAGG - Intergenic
1060843445 9:126814496-126814518 CTGAAAAAGTATTTTGGGCCGGG + Intronic
1060844929 9:126828495-126828517 TTCAAAAATAATTTTGGGCCAGG + Intronic
1060969470 9:127730074-127730096 CACAAAATGAAGAAGGGGCCTGG - Intronic
1061331024 9:129893306-129893328 ATCCAAAAGAAATTTGGGCCTGG + Intronic
1061687411 9:132292930-132292952 TTAAAAAATGAGTTGGGGCCAGG - Intronic
1061969798 9:134038583-134038605 CTCAAAAATGAGTTGCAGCCTGG - Intronic
1062252465 9:135605206-135605228 TTCAAAAAGGAGTTCTGGCCTGG + Intergenic
1062293794 9:135812671-135812693 CTCATAAAGCTGTTTGGGCCGGG + Intronic
1203639553 Un_KI270750v1:147542-147564 CTCAAAAATTAGTTGGGCCATGG - Intergenic
1185596619 X:1310949-1310971 ATCAAAAAGAGGCTGGTGCCCGG + Intergenic
1185789830 X:2920305-2920327 CTGAATCAGAAGTTGGTGCCTGG - Intronic
1185906697 X:3940049-3940071 TTCAAAAATAAGTGTGGGCCGGG - Intergenic
1186895434 X:14000299-14000321 CTAAAAAAGAAATTTAGGCCGGG + Intergenic
1187900092 X:24019549-24019571 CTTAAAAATTAGTGGGGGCCGGG - Intronic
1189473218 X:41330441-41330463 CTCAAAAAGAAGGCGGGGGTGGG - Intergenic
1189586269 X:42465280-42465302 CTTAAAAATGGGTTGGGGCCTGG + Intergenic
1190135509 X:47792999-47793021 CTCAAAAATCAGTTGAGGCTGGG - Intergenic
1190209234 X:48431470-48431492 ATTAAAAATAAGTTTGGGCCAGG - Intergenic
1190585170 X:51932573-51932595 TACAAAAAGAAGTTTGAGCCTGG - Intergenic
1190716728 X:53110627-53110649 CTCATAAAGAGTTTGGGGCCGGG + Intergenic
1190819673 X:53961612-53961634 TTTAAAAAAAAATTGGGGCCGGG - Intronic
1192197905 X:69042885-69042907 GTCAAAAATCAGTTGGGGGCTGG + Intergenic
1192581485 X:72286405-72286427 ATCAATAAGGAGATGGGGCCAGG - Intronic
1193124260 X:77854642-77854664 CTTAAAAAAAAAATGGGGCCAGG - Intronic
1193426768 X:81349051-81349073 CTAAAAAAGAAGTCCTGGCCGGG - Intergenic
1193753107 X:85372047-85372069 GTGAAAAAGAATTTGGGGCCGGG + Intronic
1194534990 X:95095050-95095072 CGTCAAAAGAAGTTGGAGCCAGG - Intergenic
1196683681 X:118493916-118493938 CTCAGGAAGAAAGTGGGGCCTGG + Intergenic
1196794101 X:119488602-119488624 TTCAAAAATAAGTTCTGGCCGGG - Intergenic
1196905967 X:120434831-120434853 CTTAAAAACCAGTTGAGGCCAGG + Intronic
1197153915 X:123249478-123249500 CTCTGAAAGAAGCTGGGGCATGG - Intronic
1197748548 X:129949548-129949570 CTCAAAAAGAAATTATTGCCGGG + Intergenic
1197843340 X:130774310-130774332 ATCAAAATGAAAATGGGGCCAGG - Intronic
1198606487 X:138344295-138344317 CTGAAAAAGAAGTTTGTGACTGG + Intergenic
1199636670 X:149819972-149819994 TTTAAAAAGCAGTTGGGGCCAGG + Intergenic
1199835116 X:151582276-151582298 CTCAAAAAAAAGCGGGGGCCAGG - Intronic
1200138161 X:153884973-153884995 CTCCAGAAGGAGTGGGGGCCTGG - Intronic
1200834051 Y:7715538-7715560 ATAAAAAAGAAGTTGAGGACTGG - Intergenic
1201284546 Y:12368051-12368073 AAAAAAAAGAAGTTGGTGCCTGG + Intergenic
1202037911 Y:20654177-20654199 CTTTAAAAGAAGTGGCGGCCGGG + Intergenic