ID: 1145077866

View in Genome Browser
Species Human (GRCh38)
Location 17:19870052-19870074
Sequence CTGTATTCACAGGCCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145077862_1145077866 0 Left 1145077862 17:19870029-19870051 CCCTTCGTTTGGACATGCGTGTC No data
Right 1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG No data
1145077859_1145077866 11 Left 1145077859 17:19870018-19870040 CCTCCAATAGGCCCTTCGTTTGG No data
Right 1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG No data
1145077861_1145077866 8 Left 1145077861 17:19870021-19870043 CCAATAGGCCCTTCGTTTGGACA No data
Right 1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG No data
1145077863_1145077866 -1 Left 1145077863 17:19870030-19870052 CCTTCGTTTGGACATGCGTGTCC No data
Right 1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145077866 Original CRISPR CTGTATTCACAGGCCAAACA TGG Intergenic
No off target data available for this crispr