ID: 1145089252

View in Genome Browser
Species Human (GRCh38)
Location 17:19973003-19973025
Sequence GCTTTAAGACTCCGTCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145089250_1145089252 -1 Left 1145089250 17:19972981-19973003 CCACTACCTTTTGTTTTGTTTTG 0: 1
1: 11
2: 74
3: 475
4: 3680
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1145089249_1145089252 0 Left 1145089249 17:19972980-19973002 CCCACTACCTTTTGTTTTGTTTT 0: 1
1: 0
2: 43
3: 669
4: 5882
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1145089251_1145089252 -7 Left 1145089251 17:19972987-19973009 CCTTTTGTTTTGTTTTGCTTTAA 0: 2
1: 3
2: 59
3: 546
4: 3407
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1145089248_1145089252 10 Left 1145089248 17:19972970-19972992 CCAAATACAACCCACTACCTTTT 0: 1
1: 0
2: 5
3: 37
4: 355
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1145089247_1145089252 17 Left 1145089247 17:19972963-19972985 CCATGGGCCAAATACAACCCACT 0: 1
1: 1
2: 26
3: 99
4: 464
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1145089246_1145089252 18 Left 1145089246 17:19972962-19972984 CCCATGGGCCAAATACAACCCAC 0: 1
1: 2
2: 29
3: 148
4: 679
Right 1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145089252 Original CRISPR GCTTTAAGACTCCGTCACCC TGG Intronic
903926086 1:26831723-26831745 GCTTTCAGACCCCCTGACCCTGG - Intronic
904746951 1:32717252-32717274 GCTTTATGCCTCCATCAGCCTGG - Intergenic
907221334 1:52908912-52908934 TTTTTGAGACTCTGTCACCCAGG - Intronic
912979216 1:114355593-114355615 TTTTTGAGACTCTGTCACCCAGG + Intergenic
914385917 1:147170603-147170625 GTTTTGAGAGTCTGTCACCCAGG + Intronic
917866983 1:179205549-179205571 GGTTGAAGACTCTGTCAGCCTGG + Intronic
918836830 1:189475803-189475825 CTTTTGAGACTCTGTCACCCAGG - Intergenic
921767877 1:218994259-218994281 CCTTTCTGACTCCTTCACCCAGG - Intergenic
923748407 1:236724577-236724599 GATTAAAGACTCCATCAGCCTGG - Intronic
1065704639 10:28460816-28460838 TTTTTAAGACTTTGTCACCCAGG + Intergenic
1065996805 10:31067037-31067059 GCTCTAATACTCTTTCACCCAGG - Intergenic
1068931333 10:62593650-62593672 GTCTTACCACTCCGTCACCCAGG + Intronic
1069950514 10:72015240-72015262 TTTTTAAGACTCTGTCACCCAGG + Intergenic
1071611936 10:87039484-87039506 GCTTTTTGGCTCTGTCACCCAGG + Intergenic
1075847395 10:125555763-125555785 GGTTTAAGACTTCCCCACCCTGG + Intergenic
1084766456 11:71312130-71312152 GCTTTTAGGCTCTGGCACCCTGG + Intergenic
1091777870 12:3196400-3196422 GCTTTAAGAGTCTGTTAGCCTGG + Intronic
1092959209 12:13579972-13579994 GCTTTAAGACTCCTCCAACCTGG + Intronic
1094603285 12:31929329-31929351 GCTTTTAGGCTCTGTCACCCAGG + Intergenic
1095741043 12:45607514-45607536 GTGTTAAGACACAGTCACCCAGG + Intergenic
1095864067 12:46952180-46952202 GTTTTATTACTCTGTCACCCAGG - Intergenic
1096376759 12:51118527-51118549 GTTTTGAGACGGCGTCACCCAGG - Intronic
1098460188 12:70724319-70724341 CCTTTAAGACTGTGTCACCTTGG + Intronic
1103310005 12:119998086-119998108 GTGGTAAGACTCCGTCGCCCAGG - Intronic
1105489077 13:20870072-20870094 TTTTTGAGACTCCTTCACCCAGG - Intronic
1105657191 13:22454281-22454303 CCTTTCAGACTCAGGCACCCGGG - Intergenic
1106545657 13:30728820-30728842 GCTTTCTCACTCTGTCACCCAGG - Intronic
1112247875 13:97750779-97750801 TCTTTGAGACACTGTCACCCAGG + Intergenic
1112691135 13:101895890-101895912 GCTTTGAGACTCCATCCCTCAGG - Intronic
1115183103 14:30652981-30653003 TTTTTGAGACTCTGTCACCCAGG - Intronic
1115274369 14:31591186-31591208 ACTTTATCACTCTGTCACCCAGG + Intronic
1116019755 14:39445886-39445908 GCAACAAGACTCTGTCACCCAGG - Intergenic
1122132215 14:99611153-99611175 CATTTGAGACTCTGTCACCCAGG + Intergenic
1123936961 15:25198678-25198700 GCCCCAAGACTCCGCCACCCTGG - Intergenic
1125704817 15:41724657-41724679 AATTTGAGACTCTGTCACCCAGG - Intronic
1134613230 16:15627590-15627612 TTTTTGAGACTCTGTCACCCAGG - Intronic
1139432367 16:66918020-66918042 GCTTTGTGTCTCCGTCCCCCAGG - Exonic
1141839639 16:86566677-86566699 GCTCTAAGACCCCGCCGCCCCGG - Intergenic
1144181745 17:12758627-12758649 GCTTTAAAATTCAGTGACCCTGG + Intronic
1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG + Intronic
1147622942 17:41880024-41880046 GATTAAAGACTCAGTCACGCTGG - Intronic
1155271221 18:24143005-24143027 TTTTTGAGACTCTGTCACCCAGG - Intronic
1155855616 18:30830672-30830694 TCTTTGAGACTCTGTCGCCCAGG - Intergenic
1160383709 18:78480566-78480588 GGATTAAGACTCTGTCACACTGG - Intergenic
1160509671 18:79446349-79446371 GTTTTAAGACCACGTGACCCTGG + Intronic
1160600388 18:80008124-80008146 TTTTTAAGACTCCATCTCCCAGG - Intronic
1161375381 19:3937161-3937183 CCCCTAAGACTCCATCACCCAGG + Intronic
1163331441 19:16640905-16640927 TTTTTGAGACTCTGTCACCCAGG - Intronic
1165210811 19:34234318-34234340 TTTTTTAGACTCTGTCACCCAGG - Intergenic
1165402499 19:35610772-35610794 GCTTTGAGACAGGGTCACCCAGG + Intergenic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1166812298 19:45521861-45521883 TTTTTGAGACTCTGTCACCCAGG - Intronic
930135209 2:47896353-47896375 GTCTTAAAACTCTGTCACCCAGG + Intronic
934638515 2:96011546-96011568 GCTTTAAGACTGTGTAACCTTGG + Intergenic
934795140 2:97093865-97093887 GCTTTAAGACTGTGTAACCTTGG - Intronic
935286593 2:101569705-101569727 TTTTTGAGACTCTGTCACCCAGG + Intergenic
936994210 2:118396563-118396585 GTTTTAAGACTCTGTCACCCAGG + Intergenic
939283777 2:140101519-140101541 ACTTTATCACTCTGTCACCCAGG - Intergenic
945204283 2:207315193-207315215 CCTTTTACACACCGTCACCCAGG + Intergenic
946720290 2:222598618-222598640 GCTTTAAGACCAGGTCATCCAGG - Intronic
948134867 2:235628835-235628857 GTTTTTTGACTCCGTTACCCAGG + Intronic
1172573779 20:35990923-35990945 TTTTTGAGACTCTGTCACCCAGG - Intronic
1172657601 20:36546562-36546584 GCTTGAAGGCTCCCTCCCCCAGG + Intronic
1175923583 20:62461460-62461482 GCTGTCAGCCTCCGTCATCCCGG + Intergenic
1179243454 21:39611319-39611341 GCTCTAAGTCTCAGTCTCCCAGG + Intronic
1183369788 22:37426023-37426045 GCTTTCTGACTCCGACAGCCTGG + Intronic
1184323831 22:43766538-43766560 TTTTTGAGACTCTGTCACCCAGG + Intronic
950246549 3:11424986-11425008 TTTTGAAGACTCTGTCACCCAGG + Intronic
951565463 3:24008533-24008555 TTTTTGAGACTCTGTCACCCAGG + Intergenic
954294092 3:49664620-49664642 GATTCCAGACTCAGTCACCCAGG + Intronic
955110853 3:55948352-55948374 GCTTTAAGTGTCAGTCAGCCAGG - Intronic
960092255 3:113653036-113653058 TTTTTGAGACTCTGTCACCCAGG - Exonic
965177218 3:165351002-165351024 GCTGTATCACTCTGTCACCCAGG + Intergenic
970611407 4:17728525-17728547 GCTTGCAGACTCCGTCTCTCGGG + Intronic
971112882 4:23608820-23608842 TTTTTAAGACTCCCTCACCCTGG - Intergenic
975148603 4:70996187-70996209 TTTTTGAGACTCTGTCACCCAGG - Intronic
984604833 4:181773183-181773205 CCTCAAAAACTCCGTCACCCAGG + Intergenic
988709813 5:33762164-33762186 TCTTTATCACTCTGTCACCCAGG - Intronic
989055873 5:37366131-37366153 GCTCTAAGACTCCATCACTAAGG + Intronic
994071677 5:95610045-95610067 GCTTTAAAACTCCTGCAGCCTGG - Intergenic
1001571522 5:172733405-172733427 GCTCCCAGACTCAGTCACCCTGG - Intergenic
1002979402 6:2121097-2121119 ACTTTCAGGCTCCGTGACCCTGG - Intronic
1004692225 6:18002639-18002661 GCTTTGTCACTCTGTCACCCAGG + Intergenic
1006828191 6:36952017-36952039 CTTTTGAGACTCCGTCACCCAGG + Intronic
1006836238 6:37000417-37000439 TTTTTGAGACTCTGTCACCCAGG + Intergenic
1012332615 6:98011723-98011745 CCTCTAAGACTGGGTCACCCTGG + Intergenic
1016900436 6:149095951-149095973 GCTTTAAGCCTCCTTAACACTGG - Intergenic
1016949553 6:149566561-149566583 GCTTTACGACTCCGACTCTCCGG + Intronic
1021709774 7:23404114-23404136 TTTTCAAGACTCTGTCACCCAGG - Intronic
1025925132 7:65952809-65952831 GAGTTAAGACTCTGTCGCCCAGG + Intronic
1026682448 7:72477441-72477463 TTTTTGAGACTCTGTCACCCAGG + Intergenic
1036124827 8:6052965-6052987 TTTTTGAGACTCTGTCACCCAGG - Intergenic
1045152227 8:99421701-99421723 TTTTTGAGACTCCATCACCCAGG + Intronic
1045217504 8:100162930-100162952 TTTTTGAGACTCTGTCACCCAGG - Intronic
1045391736 8:101721865-101721887 TTTTTAAGACTCTGTCACTCAGG + Intronic
1056387399 9:86110494-86110516 TTTTTGAGACTCTGTCACCCAGG + Intergenic
1060517241 9:124273539-124273561 GCTATAAAACCCCATCACCCTGG - Intronic
1060662844 9:125414456-125414478 GCTCCAAGCCTCTGTCACCCTGG + Intergenic
1062262881 9:135671667-135671689 GCTCTAGGGCTCCGTGACCCAGG + Intergenic
1189501997 X:41570026-41570048 TTTTTGAGACTCTGTCACCCAGG + Intronic