ID: 1145091498

View in Genome Browser
Species Human (GRCh38)
Location 17:19989870-19989892
Sequence GCTAAAGTATGTGCTCGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145091498_1145091500 -6 Left 1145091498 17:19989870-19989892 CCTTGTCGAGCACATACTTTAGC No data
Right 1145091500 17:19989887-19989909 TTTAGCCAGTTAATGTCCAAGGG No data
1145091498_1145091499 -7 Left 1145091498 17:19989870-19989892 CCTTGTCGAGCACATACTTTAGC No data
Right 1145091499 17:19989886-19989908 CTTTAGCCAGTTAATGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145091498 Original CRISPR GCTAAAGTATGTGCTCGACA AGG (reversed) Intergenic
No off target data available for this crispr