ID: 1145102533

View in Genome Browser
Species Human (GRCh38)
Location 17:20088843-20088865
Sequence TCATGAGGGTGAAGCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1624
Summary {0: 2, 1: 34, 2: 159, 3: 444, 4: 985}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145102533_1145102539 10 Left 1145102533 17:20088843-20088865 CCATGAGGGCTTCACCCTCATGA 0: 2
1: 34
2: 159
3: 444
4: 985
Right 1145102539 17:20088876-20088898 GCTTGTGCAAAACAGGCTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 133
1145102533_1145102538 3 Left 1145102533 17:20088843-20088865 CCATGAGGGCTTCACCCTCATGA 0: 2
1: 34
2: 159
3: 444
4: 985
Right 1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145102533 Original CRISPR TCATGAGGGTGAAGCCCTCA TGG (reversed) Intronic
900817021 1:4855785-4855807 TCATGAGAGCAAAGCCCTCATGG - Intergenic
900909823 1:5587121-5587143 TCCTAAGGGTGGAGCGCTCATGG + Intergenic
901834738 1:11916788-11916810 TCACGAGAGTGGATCCCTCATGG - Intergenic
902263518 1:15245135-15245157 TCATGCGGGCGAATCCCTCATGG - Intergenic
902568485 1:17331447-17331469 AGCTGAGGGTGCAGCCCTCATGG + Intronic
903820801 1:26101048-26101070 TCATGAGGGTGGAGCCATCATGG + Intergenic
903926051 1:26831555-26831577 TCATGATAGTGAAGCTATCAGGG - Intronic
904079607 1:27863689-27863711 TCATCAGGGTGGGGCCCCCATGG + Intergenic
904089104 1:27931999-27932021 TCATGAGAGTGGAGCCCTGATGG - Intergenic
904437019 1:30505678-30505700 TCTTGAGGGAGGAGCCCTCACGG - Intergenic
904631100 1:31842902-31842924 GCATAAGTGAGAAGCCCTCAAGG + Intergenic
904830304 1:33302159-33302181 TCATGAGGGTGGAGCCCCCATGG + Intergenic
904860340 1:33533116-33533138 CCTTGAGGGAGAAGCCCTCCTGG + Exonic
905027801 1:34863165-34863187 CCATGAGAGTGCAGCCCTCATGG - Intergenic
905491821 1:38350274-38350296 TCATGAGGGTGGAGCCTTCATGG + Intergenic
905495329 1:38380447-38380469 TCATGGAGGTGAATCCCTCATGG - Intergenic
905834553 1:41106276-41106298 TCATGGGGGTGGATTCCTCAGGG + Intronic
906672996 1:47671594-47671616 TCATGAAGGAGGAGCCCTCATGG + Intergenic
906730375 1:48075727-48075749 TCATGAGGGTGGAGCCCTCATGG + Intergenic
906745681 1:48220780-48220802 CCATGAGGGAGAAGCCCTCACGG + Intergenic
906857109 1:49319848-49319870 TTCTTAGGCTGAAGCCCTCAAGG + Intronic
906911304 1:49954352-49954374 TCATGAGGGCAGAGCCCTCATGG - Intronic
907151013 1:52287538-52287560 CCATGAGGGTGAAGCCCTCATGG - Intronic
907291995 1:53421193-53421215 TCATGAGGGCAGAGCCCTCATGG + Intergenic
907598677 1:55745083-55745105 TCATGAGGGAGGAGCCTTCATGG + Intergenic
907746005 1:57214266-57214288 TAATGAAGGAGAAGTCCTCATGG + Intronic
907962081 1:59293497-59293519 TCATGAGGGTGAAGCCTGCATGG + Intergenic
907979692 1:59469473-59469495 TCATGAGGGCAGAGCCCTCATGG + Intronic
908076169 1:60521274-60521296 TCATGAGGGTAGAATCCTCATGG - Intergenic
908171162 1:61506038-61506060 TCATGAGGGCCGAGCCATCATGG + Intergenic
908392481 1:63696268-63696290 TCATGAGGTTGGAACCCTCATGG + Intergenic
908483483 1:64567285-64567307 TCTTGAGGGTGATGCCCTGATGG + Intronic
908560595 1:65302415-65302437 TCATGAGGGTGGACCCCTTATGG - Intronic
908594972 1:65678258-65678280 TAATGAGGGCAGAGCCCTCATGG + Intergenic
908669202 1:66527381-66527403 TCACGAGGGAGGAGCCCTCATGG - Intergenic
908726782 1:67184891-67184913 TCATGAGGGTAAAGCCCTCATGG + Intronic
909116252 1:71541020-71541042 TCATGGGGGTGGATCCCTCATGG - Intronic
909139612 1:71846844-71846866 TCATGAGGGTAGAGCCCTCATGG - Intronic
909229495 1:73067789-73067811 TCATGTGGGAGAAGCCCTCATGG - Intergenic
909233539 1:73121755-73121777 TTATGAGGGTAGAGCCCTCATGG - Intergenic
909253938 1:73393925-73393947 TCATGAGGGTGGCTCCCTCAAGG - Intergenic
909573111 1:77140136-77140158 TCATGAGGGCAGATCCCTCATGG + Intronic
909817919 1:80019972-80019994 TCATGAGTGAGAAACCCTTATGG - Intergenic
909906039 1:81196371-81196393 TTATGAGGGAGGAGCCTTCATGG + Intergenic
910011471 1:82468821-82468843 TCATGAGGGTGGAGCCCTCATGG + Intergenic
910309832 1:85810603-85810625 TCATGGGGGTGAGTCCCTCATGG + Intronic
910378170 1:86595808-86595830 TCATGTGGGTGGATCCCCCATGG - Intergenic
910568806 1:88677414-88677436 TCATGAGGGTGAAGACCCCATGG - Intergenic
910738102 1:90484558-90484580 TCTTGAGGGTGTATCCCTCATGG + Intergenic
910897859 1:92086701-92086723 CCATGAGGGTGGAGCCCTCTTGG - Intronic
911032242 1:93501562-93501584 TCATGAGGGATCCGCCCTCATGG - Intronic
911164373 1:94712002-94712024 TAATGAAGGTGGAGCCCTCATGG - Intergenic
911168135 1:94743375-94743397 TTATAAGGATGGAGCCCTCATGG + Intergenic
911190051 1:94939374-94939396 TCATGAGAGAGAAGCCTTCATGG - Intergenic
911197580 1:95011220-95011242 TCATAAGGGTGGGACCCTCATGG + Intronic
911269057 1:95778288-95778310 TAATGAGAGTGAAGCCCTTGTGG - Intergenic
911270449 1:95795368-95795390 TCAAGAGGGTAGAGCCCTCATGG + Intergenic
911408224 1:97468375-97468397 TCATGAGGGTGGGGTCCTCATGG + Intronic
911819786 1:102403090-102403112 TCATGGGGGTGGATCCCTCATGG - Intergenic
911844972 1:102741191-102741213 TCATGGGGGCTAATCCCTCATGG - Intergenic
912093283 1:106108434-106108456 TGATGAGGGCAGAGCCCTCATGG + Intergenic
912211290 1:107559984-107560006 TCATGGGAGTGGATCCCTCATGG - Intergenic
912509467 1:110178780-110178802 TCATGACGGTGGAGCCCTGACGG - Intronic
912632695 1:111259990-111260012 TCATGAGGGAGGAGCCCATATGG + Intergenic
912786692 1:112610647-112610669 TCATGAGGGCAGTGCCCTCAGGG - Intronic
912792476 1:112665738-112665760 TCATGAGGATGAAGCCTTCAAGG - Intronic
912883764 1:113447414-113447436 TCATAAGGGCACAGCCCTCATGG + Intronic
913286438 1:117230979-117231001 TCATGGGGGAGAATCCCCCATGG + Intergenic
914926800 1:151895793-151895815 TCATGGGGGTGAATTTCTCATGG + Intronic
915006140 1:152638835-152638857 TCATGATGGTGGAGCCCTCATGG - Intergenic
915248230 1:154570848-154570870 TCATGAGGGTGGAGAAGTCAGGG - Intronic
915280405 1:154818536-154818558 TCACAAGGGAGGAGCCCTCATGG - Intronic
915291481 1:154887257-154887279 ACATAAGGGTGAACTCCTCAAGG - Intergenic
915800523 1:158787093-158787115 TCATGGGGGTGAATTCCTCATGG + Intergenic
916383774 1:164244089-164244111 TCATGAGGGTCCCACCCTCATGG - Intergenic
916479200 1:165200226-165200248 GCATGAGGGGGAAGGCCTTAGGG - Intergenic
916506497 1:165432989-165433011 TTATGAGGGTGGTGCCCTCATGG - Intronic
916515344 1:165511507-165511529 TCATGAAGATGGAGCTCTCATGG + Intergenic
916801285 1:168218958-168218980 TCATGAGGGCAGAGTCCTCATGG + Intergenic
916811244 1:168307469-168307491 TCCTGAGGGTAGAGCCCCCATGG + Intronic
916850661 1:168700179-168700201 TCATGAGAGCAGAGCCCTCATGG - Intronic
916901360 1:169227684-169227706 TCATCATGGTGAGGCCCACATGG - Intronic
917122970 1:171660377-171660399 TCATGGGTGTGGATCCCTCATGG - Intergenic
917314250 1:173708314-173708336 TCGTGAGTGTGGAGCCCTCATGG - Intergenic
917354417 1:174111423-174111445 TCACAGGGGAGAAGCCCTCATGG - Intergenic
917435094 1:175012891-175012913 CCATGAGTGTGGAGCCCTCCTGG + Intronic
917554658 1:176071130-176071152 TCATGGAGATGAATCCCTCATGG + Intronic
918192146 1:182185941-182185963 TCATGAGGGTGGAGCCCTCATGG + Intergenic
918313017 1:183300017-183300039 TCATGAGGATGGAACCCTCGTGG + Intronic
918392886 1:184084765-184084787 CCATGAGGGTGGAGCCCTCATGG + Intergenic
918440181 1:184559178-184559200 TCATGGGGGAGGATCCCTCATGG + Intronic
918692339 1:187497119-187497141 TCATGGGGGCGGATCCCTCATGG - Intergenic
918704554 1:187644207-187644229 ACATGAAAGTGGAGCCCTCATGG + Intergenic
918791310 1:188834157-188834179 TCATGACGATGGAGCCCTCATGG - Intergenic
918963686 1:191312152-191312174 TCATGGGGGCGGATCCCTCATGG + Intergenic
919149581 1:193678769-193678791 TCATGAGGGTGGATCACTCATGG + Intergenic
919434368 1:197538837-197538859 CCAAGAGGGTGGAACCCTCATGG - Intronic
919536913 1:198798490-198798512 CCATGAGGGTGGAGCCCCCATGG - Intergenic
919577587 1:199331035-199331057 TCATGGGGGAGGATCCCTCATGG - Intergenic
919783917 1:201245119-201245141 TCATGAGGGTGGGCCCCTCATGG + Intergenic
919851345 1:201675078-201675100 TCATGGGAGTGGATCCCTCATGG - Intronic
920159564 1:203985908-203985930 TCATGAGAGCAGAGCCCTCATGG + Intergenic
920246416 1:204590934-204590956 TCATGGGGATGGATCCCTCACGG - Intergenic
920275419 1:204800843-204800865 TCATGAGGGCAGAGTCCTCATGG - Intergenic
920347066 1:205313382-205313404 ACATGAGGACGAAGCCCTCCAGG + Intronic
920370699 1:205477623-205477645 TCCTGATGGTTAACCCCTCAGGG - Intergenic
920586286 1:207165525-207165547 TATCGAGGGTGGAGCCCTCAAGG - Intergenic
920972493 1:210754519-210754541 TCACGGGGGTGGATCCCTCATGG + Intronic
921128175 1:212196341-212196363 TCATGAGGGTGGATCCCTCATGG + Intergenic
921134149 1:212245149-212245171 TCATCGGGGAGAATCCCTCATGG + Intergenic
921211007 1:212897792-212897814 TCCTGCGGGTGGATCCCTCATGG - Exonic
921257371 1:213354789-213354811 TCATGAGGGCAAAGCCCTAAAGG - Intergenic
921336463 1:214091992-214092014 TCATGAGGGAGGAGCACTTATGG - Intergenic
921443947 1:215222123-215222145 TCATGGGGGTGGATCCCTCATGG - Intronic
921577313 1:216851470-216851492 TCATGAGAGTGGAGCCCTCATGG + Intronic
921618934 1:217305296-217305318 TCATGGGGGAGGATCCCTCATGG + Intergenic
921756022 1:218856512-218856534 TCATAAGAGTGAAGCCCTCATGG - Intergenic
921892508 1:220367285-220367307 GCATGAGGGTGAAGCCCTCCTGG - Intergenic
921925637 1:220708085-220708107 TCATGAGGGAGGAGCCCTCGTGG + Intergenic
921981920 1:221268060-221268082 TCATGAGGGTGGATCCCTCGTGG - Intergenic
922025683 1:221746453-221746475 TCATGAGGGCAGAGGCCTCATGG + Intergenic
922073003 1:222215065-222215087 GTATGAATGTGAAGCCCTCAGGG - Intergenic
922335185 1:224613599-224613621 TCATGGGGGTGGATCCCTCATGG + Intronic
922360374 1:224816095-224816117 TCATGAGGGAGGAGCCCTTATGG + Intergenic
922414191 1:225405443-225405465 TCATGAGGGTTCTGCCCTCATGG + Intronic
922417806 1:225437825-225437847 CCATGAGGGTGCAGCCCTCATGG - Intergenic
922886479 1:229024663-229024685 ACCTGAGGCTGATGCCCTCATGG + Intergenic
922999746 1:229997112-229997134 TCATGAGGGTAGAGCACTCTTGG - Intergenic
923031948 1:230256092-230256114 CCATGAGAGTGGAGCCCTCATGG + Intronic
923096084 1:230776278-230776300 TTGTGAGGGTGGAGCCCTCATGG - Intronic
923097005 1:230783417-230783439 TCATGGGTGTGGATCCCTCATGG + Intronic
923319468 1:232816370-232816392 TCATGAGGACAGAGCCCTCATGG + Intergenic
923533931 1:234833825-234833847 TCATGAGGGTGGAGCCCTCACGG - Intergenic
923676922 1:236088312-236088334 TCATGAGGGCAGAGCCCTCATGG + Intergenic
923859271 1:237876811-237876833 CCATGAGGGTGATGCTCTCATGG - Intergenic
923999750 1:239537465-239537487 TCATGGGGGCGGATCCCTCATGG - Intronic
924163358 1:241256751-241256773 TCATGAGTGTGAAGCCCTCCTGG - Intronic
924542407 1:244993843-244993865 TCATGAGGGCAGAGCCCTCGTGG + Intronic
1062778061 10:172124-172146 TCATGAGGGCAGAGCCCCCATGG + Intronic
1063466700 10:6250615-6250637 TCACAAGGGAGGAGCCCTCAGGG - Intergenic
1063858746 10:10285309-10285331 TCATGGGGGCGGATCCCTCATGG + Intergenic
1064125375 10:12655314-12655336 TCATGGGGGTGGATCCCTCATGG - Intronic
1064257205 10:13752709-13752731 TCATGAAGGTCAAGTTCTCAGGG + Intronic
1064780833 10:18836318-18836340 TCATGAGGGTTGAGCCCTCATGG + Intergenic
1065074851 10:22066988-22067010 TCATGAGGGAGGAGCCCTCATGG + Intergenic
1065180653 10:23121403-23121425 TCATGAGGGTGGATCCCTCATGG - Exonic
1065460351 10:25956156-25956178 TCATGAGGAAGATGCCTTCATGG + Intronic
1065554366 10:26900123-26900145 CCATGAAGGTGGAGCACTCATGG + Intergenic
1065640210 10:27774418-27774440 TCATGAGGTCAGAGCCCTCATGG + Intergenic
1065663425 10:28030912-28030934 TCATGAGGGCAGAGCCCTTATGG - Intergenic
1065678907 10:28208914-28208936 TCATGGGGGTGGATCCCTCATGG + Intronic
1065863515 10:29892508-29892530 TCATGAGGGCAAAGCCCTCATGG + Intergenic
1066251580 10:33637984-33638006 TCATGAGGGTGGAACCCTCCTGG + Intergenic
1067260147 10:44682409-44682431 TCAAGAGGGTCAAGCCCTCTTGG - Intergenic
1067668832 10:48301485-48301507 TCAGGAGGGTGGGGCCCACATGG + Intergenic
1067739763 10:48886438-48886460 TCATGAGGGTCATGCTCTCATGG - Intronic
1068282808 10:54898041-54898063 TCATGAGGGCAGATCCCTCATGG + Intronic
1068291431 10:55006543-55006565 TCATGGGGGTGGATCCTTCATGG + Intronic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1068507993 10:57927444-57927466 TCATGGGGGTGGATCCCTCATGG - Intergenic
1068766803 10:60773501-60773523 TAATGAGGGAAAAGCCCTCGAGG + Intergenic
1068987453 10:63120446-63120468 TCATAAGGGTGGAGCCATTATGG - Intergenic
1069096629 10:64267305-64267327 TCATAAAGGTGAAGCCCTTATGG + Intergenic
1069344407 10:67451039-67451061 TCATGAGGATGGAGCCTTCATGG - Intronic
1069576877 10:69537018-69537040 TCATAAGGGTGGGGCCCTAATGG - Intergenic
1069692451 10:70362925-70362947 TCGTGAGGGTGGAGCCCCCATGG + Intronic
1069881472 10:71596387-71596409 GCATGAGTCTGAAGTCCTCAGGG + Intronic
1069938441 10:71936407-71936429 TTATGAGGGTGGAGCCCTCTTGG + Intergenic
1069946339 10:71988412-71988434 TCATGGGGGTGGATCCCTCATGG + Intronic
1070145926 10:73773144-73773166 TCATGAGGGTGCGGCCCTGGAGG - Intronic
1070581752 10:77725558-77725580 TCATGGGGGTGTTTCCCTCATGG + Intergenic
1070730592 10:78825267-78825289 TCATGAGGGCAAAGGCCTCCTGG - Intergenic
1071266614 10:83970322-83970344 TAATTTGGGTCAAGCCCTCATGG + Intergenic
1071398901 10:85250218-85250240 TCATGAGGGCATAGCCCTCATGG + Intergenic
1071918763 10:90325979-90326001 TCATGAGGGACAAGTCCTTATGG + Intergenic
1071959663 10:90798025-90798047 TGATGAGGGTAGATCCCTCATGG + Intronic
1071964835 10:90842147-90842169 TCATGAGGTTAGAGCCCTCATGG + Intronic
1072215802 10:93286192-93286214 GCATGAGGGTGCAGCCCTCATGG + Intergenic
1072459000 10:95602644-95602666 TCGTGAGGGTGGGGCCCTCATGG - Intergenic
1072499306 10:95996873-95996895 TCATAAGGGTGGAGCTCTCATGG - Intronic
1072505528 10:96062643-96062665 TCATGGGGGCGGATCCCTCATGG - Intergenic
1072718576 10:97767275-97767297 TCATCTGGGTGAAGACCTCAGGG - Exonic
1073368430 10:102964891-102964913 TCATGAGGGAGAAGCCCTCATGG - Intronic
1073583879 10:104690530-104690552 GCCTGAGGGTGAAGCACTCCAGG - Intronic
1073629523 10:105134619-105134641 TCCTGAGGAAGAAGCCCTCATGG + Intronic
1073684247 10:105735215-105735237 TCATAAGAGTGGAGCCCTCATGG - Intergenic
1073807211 10:107110578-107110600 TTATGAGGGTGGATCCCTCATGG - Intronic
1073814141 10:107187309-107187331 TCATGAGGGTGGATCCCTCATGG + Intergenic
1073886618 10:108047138-108047160 TCATGAGGATAGATCCCTCATGG - Intergenic
1074244971 10:111680634-111680656 TCATGAGGGCAGATCCCTCAAGG - Intergenic
1074423606 10:113331097-113331119 TCATGAGGGTGGAGTCCTTATGG + Intergenic
1074473702 10:113750479-113750501 TCCTGGGGGTGGATCCCTCATGG - Intergenic
1074620082 10:115109525-115109547 TCATGAGGGCTATGCTCTCATGG + Intronic
1075211513 10:120495180-120495202 TTATGAGGGTGAAGTCCTGTTGG + Intronic
1075527029 10:123195481-123195503 ACATGAGGGTGAGCCGCTCATGG + Intergenic
1076004720 10:126939217-126939239 TCAGGAGGATGAAACCTTCACGG - Intronic
1076106755 10:127829541-127829563 CCAGGAGGATAAAGCCCTCAGGG - Intergenic
1076452103 10:130563397-130563419 AGATGAGGGTGGAGCCCTCCTGG + Intergenic
1076505214 10:130967977-130967999 TCATGGGGGTGGATACCTCATGG + Intergenic
1077447785 11:2607452-2607474 TCATGAGGGTGGAGACCTCATGG + Intronic
1077719529 11:4613719-4613741 TCATGAGGGCAGAGCCCTCCTGG + Intergenic
1078152564 11:8771894-8771916 TCATGAGGGTGGAGCCCTCATGG + Intronic
1078470918 11:11585941-11585963 TCATGAGGGTAGAGCCCTCATGG + Intronic
1078568602 11:12438497-12438519 TCATGAGGGCTGAGCCTTCATGG + Intronic
1078587021 11:12600713-12600735 TCATGAGAGTGGAGCCCTCATGG + Intergenic
1078824605 11:14916988-14917010 TCATAAGGGCAGAGCCCTCATGG + Intronic
1078890265 11:15549343-15549365 CCATGAAGGTGGAGCCCTCATGG - Intergenic
1078890818 11:15556950-15556972 TCAGAAGGGAGAAGCCTTCATGG - Intergenic
1079531105 11:21454821-21454843 TCACGAAGGTGAAGACCCCATGG - Intronic
1079547289 11:21647781-21647803 CCATGACGGTGAAGCTCTTAGGG - Intergenic
1079613162 11:22457987-22458009 TCATGAGGGGGAAACCCTCATGG - Intergenic
1079657682 11:23002794-23002816 TTACAAGGGTGAAGCTCTCAAGG + Intergenic
1079710110 11:23672218-23672240 TGTTGAGGCTGAAGCCCCCATGG + Intergenic
1079827880 11:25220982-25221004 TCATGAAGGTGGATTCCTCATGG + Intergenic
1080136083 11:28856870-28856892 TCATGACGGTGAATCCCTAATGG - Intergenic
1080166224 11:29241082-29241104 CTATGAGGATAAAGCCCTCATGG - Intergenic
1080307771 11:30854933-30854955 CCATGGAGGTGGAGCCCTCATGG - Intronic
1080351806 11:31393489-31393511 CCATGAGGGTGGAGCCCTCACGG - Intronic
1080369482 11:31618507-31618529 CCATGATGGTGGAGCCCTTATGG + Intronic
1080501243 11:32873386-32873408 TCATGAGGGTGGAGCCCTCAAGG - Intergenic
1080577507 11:33613626-33613648 TCATGGGGGTGGATCCCTCATGG - Intronic
1080882665 11:36337243-36337265 TCAGGAGGATGGAGTCCTCATGG - Intronic
1080926679 11:36764551-36764573 TGATGAGGACAAAGCCCTCATGG + Intergenic
1080991355 11:37539788-37539810 TCATGAGGATGACTCCCTCATGG - Intergenic
1081182076 11:39996225-39996247 TCATGAGGATGGAGTCTTCATGG - Intergenic
1081182457 11:40000832-40000854 TCATGAGGGTGAAGCCCTCATGG + Intergenic
1081265285 11:41013967-41013989 TCATGGGGGTGGATCCCTCATGG - Intronic
1081508150 11:43739622-43739644 TCATGAGGGAGGAGACTTCATGG + Intronic
1081792897 11:45801554-45801576 TCATGAGAGTGGAGCCCTCATGG + Intergenic
1081866453 11:46363039-46363061 TCTTGGTGTTGAAGCCCTCAGGG + Intronic
1082036870 11:47652069-47652091 TCATGGGGGCGGATCCCTCATGG + Intergenic
1082088874 11:48072385-48072407 CCATGAGGGTGGAGTCCTAATGG + Intronic
1082198931 11:49339473-49339495 TCATGAGAATAAAGCCCTCATGG + Intergenic
1082279781 11:50259600-50259622 TCATGAGGAAGGAACCCTCATGG - Intergenic
1082699480 11:56409987-56410009 TGTTGGGGGTGTAGCCCTCATGG + Intergenic
1083255418 11:61492449-61492471 TCATGGGAGTGGATCCCTCATGG + Intergenic
1083279718 11:61619371-61619393 TCCTGGGGGTGGAGGCCTCAGGG + Intergenic
1084925586 11:72508789-72508811 TCATGGGGGTGGATCCCTCACGG - Intergenic
1085241242 11:75058254-75058276 TCATGGGGGTGGATCCCTTATGG - Intergenic
1085599378 11:77841184-77841206 TCATGAGGGTGGAACCCTCATGG + Intronic
1085662009 11:78376906-78376928 TCATGGGAGTGGATCCCTCATGG + Intronic
1085675527 11:78513858-78513880 TCATAGGGGTGGATCCCTCATGG + Intronic
1085851497 11:80125259-80125281 TCATGGAGGTGAATCCTTCATGG + Intergenic
1086339961 11:85838684-85838706 TCACGGGGGTGAATCCCTCATGG - Intergenic
1086470750 11:87107038-87107060 TCATGGGGTTGGATCCCTCATGG - Intronic
1086656880 11:89368614-89368636 TCATGAGAATAAAGCCCTCATGG - Intronic
1086774422 11:90812451-90812473 TCATGGGGGCAAATCCCTCATGG - Intergenic
1086776577 11:90842686-90842708 TCATAAGGGTGAAGTCCTCATGG + Intergenic
1086823444 11:91465661-91465683 TCATGAGGGCTGAGCTCTCATGG + Intergenic
1087097163 11:94330275-94330297 TCATGACGGCAAAGCCCTCATGG - Intergenic
1087128767 11:94651353-94651375 CCTTAAGGGGGAAGCCCTCAGGG + Intergenic
1087149352 11:94844704-94844726 TCATGAGGGCTGAACCCTCATGG + Intronic
1087192346 11:95268172-95268194 TCATGGGGGTGGATCCCTCATGG + Intergenic
1087198693 11:95323727-95323749 TCATGAGGGTGGAATCCTCATGG + Intergenic
1087224062 11:95578403-95578425 TCATGAGGGTGAAGCCTTCATGG - Intergenic
1087253676 11:95931554-95931576 TCATGGGGGTAGATCCCTCATGG - Intergenic
1087301238 11:96438997-96439019 TCATGGGAGTGCATCCCTCATGG - Intronic
1087539641 11:99499339-99499361 TCATGAGGGAGAAGTCCTCATGG - Intronic
1087778071 11:102274879-102274901 TCATGAGGGAGGAGCCCTCATGG + Intergenic
1088073757 11:105821622-105821644 TCATGGGGGTGGATCCCTCATGG - Intronic
1088131145 11:106492483-106492505 CCATAAAGGTGAAGCCCTCGTGG - Intergenic
1088609427 11:111563095-111563117 TCATGAGGGCTTTGCCCTCATGG + Intergenic
1088708507 11:112484901-112484923 TCATGAGGGAGGAGCCCTCATGG + Intergenic
1088815256 11:113416444-113416466 TAATGAAGCTGCAGCCCTCAGGG - Intronic
1089001456 11:115055423-115055445 TCAAGGGGGTGAAGCCCTGCTGG + Intergenic
1089109391 11:116043255-116043277 TCATGAGGGTGGAGCCCCCATGG + Intergenic
1089143814 11:116309768-116309790 TCATGAGGGCAGAGCACTCAAGG + Intergenic
1089612666 11:119678175-119678197 TCTTCAGGTTGAAGCCCACAAGG - Intronic
1089741097 11:120584598-120584620 TCATGAGGGTGGATCCCTTGTGG - Intronic
1089942346 11:122431590-122431612 TCATGAGGGAGGAGCCCTCATGG - Intergenic
1090136528 11:124204786-124204808 TCATAATGGTGAAGCCCTCCTGG - Intergenic
1090550760 11:127817414-127817436 CCATGAGGGTGGAGCCCTCCTGG - Intergenic
1090762716 11:129851210-129851232 TCAGGAGGGAGGGGCCCTCATGG + Intronic
1090986101 11:131767533-131767555 TCAAGAGGGAGAAGCACCCATGG + Intronic
1090994078 11:131849529-131849551 TCATGGGGGCGGATCCCTCATGG - Intronic
1091197538 11:133744815-133744837 TCATGAGGCTGGAGCCATCTGGG - Intergenic
1091301687 11:134512032-134512054 TCCAGATGGTGAAGCCCTCTCGG - Intergenic
1092082377 12:5727156-5727178 TCATGGGGGTGGATCCCTCATGG + Intronic
1092747959 12:11691176-11691198 TCATGAGGGTAGAGCCCTCATGG - Intronic
1092775481 12:11941716-11941738 TCATGAGGATGGAGCTCTCATGG - Intergenic
1092927287 12:13282847-13282869 TCATGAGGACAGAGCCCTCATGG + Intergenic
1092936554 12:13369203-13369225 TCACCAGGGAGAAGCCCTCTTGG + Intergenic
1093146678 12:15575053-15575075 TCATGAGGGTGAGGACTTCGTGG + Intronic
1093412288 12:18881063-18881085 TCTTGCGGGTGGAGCCCACATGG - Intergenic
1093440844 12:19194003-19194025 TCATGGCGGTGGATCCCTCATGG - Intronic
1093558976 12:20515085-20515107 CCATGAGGGTAGAGCCCTCAGGG + Intronic
1093762088 12:22922034-22922056 TCAGGAGGCTGGAGCCCTCAGGG - Intergenic
1093790695 12:23245943-23245965 TTATGAGGGTGGAACCCTCATGG - Intergenic
1093959961 12:25261720-25261742 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1094386922 12:29904637-29904659 TCTTAAGGGTGATGACCTCAGGG - Intergenic
1094396666 12:30014131-30014153 TCATGAGGGTCCCACCCTCATGG - Intergenic
1094708773 12:32940616-32940638 TCATGGGAGTGGATCCCTCATGG + Intergenic
1095189655 12:39242270-39242292 TCCTAAGGGAAAAGCCCTCATGG + Intergenic
1095227835 12:39698245-39698267 TCATGAGGATGGAGCACTCATGG - Intronic
1095242485 12:39877910-39877932 TCATGGAGGTGGATCCCTCAAGG + Intronic
1095388737 12:41679919-41679941 TCATGGGGGTGGATCCCTCATGG + Intergenic
1095578785 12:43770850-43770872 TCATAAGGGCAAAGCTCTCATGG - Intronic
1095717302 12:45360418-45360440 TCATGAAGGATGAGCCCTCATGG + Intronic
1095788260 12:46135070-46135092 TCATGAGGGTTCTGCCCTCATGG + Intergenic
1095930324 12:47619120-47619142 TCATGAAGGTGGAGCACTCTTGG + Intergenic
1096464608 12:51841329-51841351 TGATGTGTGTGAAGCACTCAGGG - Intergenic
1097215531 12:57408764-57408786 TCATGAGGGTGGAACTCTCATGG - Intronic
1097436883 12:59561020-59561042 TCATAAGGGCAAAGTCCTCATGG - Intergenic
1097776078 12:63648038-63648060 TCATGAGGGGGGAGTCTTCATGG - Intronic
1098103294 12:67042009-67042031 TCATGAGGGTGAGGCCCTCATGG - Intergenic
1098141054 12:67450573-67450595 TCATGGGGGTGGATCCTTCATGG + Intergenic
1098421788 12:70305301-70305323 TCATGAGGGTGGAGCCAAGATGG - Intronic
1098820167 12:75217846-75217868 TCATAAGTGTGGAGCCCTCATGG + Intergenic
1098854141 12:75633291-75633313 TCATGAGAATGGAACCCTCATGG + Intergenic
1098996718 12:77129049-77129071 TAATGATGGAGGAGCCCTCAGGG - Intergenic
1099460866 12:82919283-82919305 TCACAAGGGTGAAGCCCTCATGG - Intronic
1099513944 12:83572007-83572029 CCATGAAGGTGGAGCCCTCGTGG + Intergenic
1099621292 12:85005555-85005577 GCTTCAGGGTGAAACCCTCATGG + Intergenic
1099741899 12:86648448-86648470 TCATGAGGGTGGGGCTTTCATGG + Intronic
1100017457 12:90028049-90028071 TGAGGAGGGTGAATCACTCATGG - Intergenic
1100172694 12:91993614-91993636 CCTTGAGGGTGGAGCTCTCATGG - Intronic
1100216232 12:92451665-92451687 TCATGAGGGTTCTGCCTTCATGG - Intergenic
1100339643 12:93666163-93666185 TCATGAGGGCGGAGCCCTCATGG + Intergenic
1100378351 12:94038627-94038649 TCATGGAGGCGAATCCCTCAGGG - Intergenic
1100450097 12:94697465-94697487 TCATGAGGGTAGATGCCTCACGG + Intergenic
1100933855 12:99640431-99640453 TCATGAGGGCAAAGTCCTCATGG - Intronic
1101207708 12:102505326-102505348 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1101634333 12:106525417-106525439 TCATGAGGGAGCCGCCCTCATGG - Intronic
1102541973 12:113627446-113627468 TCATGGGTGTGGATCCCTCATGG - Intergenic
1102601656 12:114036028-114036050 TCCTGAGGCTGAAGCATTCAAGG - Intergenic
1103645604 12:122389898-122389920 TCATGGGGGCGGATCCCTCATGG + Intronic
1104112376 12:125716271-125716293 TCATGGGAGTGGACCCCTCATGG - Intergenic
1104133595 12:125917328-125917350 CCATGAGGGTGGAGCCCTCATGG + Intergenic
1104572724 12:129939123-129939145 TTATGTGGGTGAATCCCTCATGG - Intergenic
1104588750 12:130067841-130067863 TCATGAGGGCGGAGCCCTCTTGG + Intergenic
1105395414 13:20029301-20029323 TCACGAGGGTGGAGCTCTAATGG + Intronic
1105421135 13:20253459-20253481 TCATGAGGGCAAATCCCTCACGG - Intergenic
1105518413 13:21110817-21110839 TCATTAGGGAGGAGCCCTCATGG - Intergenic
1105533129 13:21237821-21237843 TCATGGGGGTGGATCCGTCATGG + Intergenic
1105724347 13:23147129-23147151 GCATGAGTGTGCAGCCCTGAAGG - Intergenic
1105797741 13:23873140-23873162 GCGTGAGGATGAAGCCTTCATGG + Intronic
1105824256 13:24108186-24108208 TCACGAGGGTGGAGCTCTCATGG - Intronic
1105936208 13:25101897-25101919 TCATGAGAGTGAAATCCTCGGGG - Intergenic
1106366048 13:29082092-29082114 TCATGAGGATGAAGCCCCCATGG + Intronic
1106738930 13:32618118-32618140 TCATAAGGGAGGAGCCCTCGTGG + Intronic
1106782732 13:33075978-33076000 TAATGAGGAAGAAGCTCTCATGG + Intergenic
1107088030 13:36446924-36446946 TAATGAGGGAGAAGGCCTGAGGG + Intergenic
1107105014 13:36633672-36633694 TCATGAGGGAGGACCCCTCCTGG - Intergenic
1107113242 13:36720279-36720301 TGGTGAGGGTGAAGCCGTGATGG - Intergenic
1107225747 13:38045496-38045518 ACATGTGGGTTAAGCACTCAAGG - Intergenic
1107295354 13:38901653-38901675 TGATGAGAGTGGTGCCCTCATGG - Intergenic
1107414052 13:40184691-40184713 TCCTAAGGGTGGAGCCCTCATGG - Intergenic
1107435646 13:40378332-40378354 TCACGGGGGTGGATCCCTCACGG + Intergenic
1107496497 13:40930584-40930606 CCATGAAGGTGGAGCCCTCCTGG - Intergenic
1107542477 13:41403947-41403969 TCATGAAGGTAGAGCCCTCTTGG - Intergenic
1107635365 13:42386920-42386942 TTATCAGGGTGGATCCCTCATGG - Intergenic
1107744244 13:43488231-43488253 TCATGAGGGAGGAGTCCTCATGG - Intronic
1107766780 13:43743997-43744019 TCATGAGGGCTTTGCCCTCATGG - Intronic
1107880610 13:44829137-44829159 TCATGAGGGCTCGGCCCTCATGG - Intergenic
1107999516 13:45893539-45893561 TCATGAGAGTGCAGCCCTTCTGG - Intergenic
1108109340 13:47051329-47051351 TCATGAGGATGGGGCCCCCATGG - Intergenic
1108259032 13:48638682-48638704 TCATGGGGGTGGATTCCTCATGG - Intergenic
1108545694 13:51490997-51491019 TCATGAGGATAGATCCCTCATGG + Intergenic
1108827969 13:54439006-54439028 TCATGAAGGTCAAGTCCTCATGG + Intergenic
1108863946 13:54899083-54899105 TTATGAGTGTGGATCCCTCATGG + Intergenic
1109057295 13:57567144-57567166 TCATGAGAGTGGAGTCCTCATGG - Intergenic
1109117473 13:58406880-58406902 TCATGAAGATGGAGCCCTCATGG + Intergenic
1109160589 13:58969109-58969131 TCATGAGGGTGGGGCTCCCATGG + Intergenic
1109602584 13:64651157-64651179 TCATGGGGGTGGAGCTCTCATGG - Intergenic
1109690348 13:65879880-65879902 CCACGAGGGAGAAGCCCTCCTGG + Intergenic
1109771623 13:66982025-66982047 TCATGGGGGCGGATCCCTCATGG + Intronic
1109843431 13:67951371-67951393 TTATAAGGGTGGATCCCTCATGG - Intergenic
1109969974 13:69755113-69755135 TCATGGGGGTGGATCCCTCATGG + Intronic
1110015313 13:70392892-70392914 TCATGAAGGAGAAGCCCTCAGGG - Intergenic
1110242439 13:73283947-73283969 TCATGGGGGTGGATCCCTCGTGG - Intergenic
1110244877 13:73311376-73311398 TCATGAGGATGGAGCCCTCATGG + Intergenic
1110325293 13:74207199-74207221 TCATGAGGACAGAGCCCTCATGG + Intergenic
1110372606 13:74756605-74756627 CCATGAAGGTGGAGTCCTCATGG - Intergenic
1110550701 13:76808165-76808187 TCATGGGGGCAAATCCCTCATGG + Intergenic
1110669051 13:78154674-78154696 TCATGGGGGCAAATCCCTCAAGG - Intergenic
1110823723 13:79947187-79947209 TCATGAGGGAGGAGCCTTCATGG - Intergenic
1111153002 13:84283249-84283271 TCATAAGGGTGTAGCCCTGATGG + Intergenic
1111170153 13:84516449-84516471 TCATGTGGGTGGATCCCTCATGG + Intergenic
1111341370 13:86890774-86890796 TCATGAGGATCCAGCCCTCATGG + Intergenic
1111490270 13:88963118-88963140 TCACGAGGGAGAAGCCTTCATGG + Intergenic
1111804404 13:93021310-93021332 TTATGAGGGCAAATCCCTCATGG - Intergenic
1111874629 13:93878267-93878289 CCATGAGGGTGGAACCCTCATGG - Intronic
1111909893 13:94299514-94299536 ACATCTGGGTGAAGCCCTCATGG + Intronic
1111999452 13:95196490-95196512 CAATGAGGGAGGAGCCCTCATGG - Intronic
1112035940 13:95496714-95496736 TCATGAGGGTGGGGCCCCCGTGG - Intronic
1112074721 13:95899029-95899051 TCATGAGGGCAGAGCCCTCGTGG - Intronic
1112118086 13:96379318-96379340 TCATGAGGGCAGAGCCCTCCCGG + Intronic
1112123692 13:96441006-96441028 TCATGAAGGTGGAGCCCTATTGG + Intronic
1112140125 13:96632076-96632098 CCAGGAGGGTGGAGCTCTCATGG - Intronic
1112282183 13:98072865-98072887 CCATGAGGGTGGAGCCCTCATGG - Intergenic
1112340558 13:98549490-98549512 TCATGGGGGTGGATCCCTCGCGG + Intronic
1113083833 13:106546972-106546994 TCATGAGGATGAACCCCTCATGG - Intronic
1113248545 13:108425975-108425997 TCATGAGGGTGGATCTCTCATGG - Intergenic
1113250039 13:108442587-108442609 TTGTAAGGATGAAGCCCTCATGG + Intergenic
1113273483 13:108701345-108701367 TCATGAGGGCAGAGTCCTCATGG - Intronic
1113491859 13:110698667-110698689 CCAAGAGGGTGGGGCCCTCACGG - Intronic
1113754197 13:112798130-112798152 TCATGAGGGAGGAGCCCGCATGG + Intronic
1114033110 14:18593711-18593733 TTATGGAGGTGAATCCCTCATGG + Intergenic
1114077903 14:19172908-19172930 TTATGGAGGTGAATCCCTCATGG + Intergenic
1114125833 14:19724054-19724076 TTATGGAGGTGAATCCCTCATGG - Intronic
1114139906 14:19897816-19897838 TCATGAGGGTGGACCCCTCATGG - Intergenic
1114637985 14:24199272-24199294 TCATGGGGGCGGACCCCTCATGG + Intronic
1114719623 14:24867119-24867141 TCGTGAGGTTGGAGCTCTCATGG - Intronic
1114951225 14:27756574-27756596 TCATGAGGGAGGATCTCTCATGG + Intergenic
1115114651 14:29865448-29865470 TCATGAGGGCAGAGCCCTCAAGG - Intronic
1115196557 14:30806788-30806810 TCGTGGGGGTGGATCCCTCATGG - Intergenic
1115311840 14:31986320-31986342 ACATGAGGGTGGAGCCCTGATGG - Intergenic
1115840936 14:37469690-37469712 TCATGAGGGCAGAGCCCTCATGG - Intronic
1115940792 14:38607894-38607916 TCATGAAGGTGTAGACCTCGTGG + Intergenic
1115972628 14:38962864-38962886 TCATAAGAGTGGATCCCTCATGG + Intergenic
1116028184 14:39538474-39538496 TCTTGGGGGTGGAGCCCCCAGGG + Intergenic
1116171502 14:41408118-41408140 TCATGAGGGTGAAACTCTCATGG + Intergenic
1116214310 14:41991533-41991555 TAATGAAGGTGTAGCCCTCATGG + Intergenic
1116222193 14:42102419-42102441 TCATAAGAGTGAGCCCCTCATGG - Intergenic
1116260095 14:42613848-42613870 TAATCACGCTGAAGCCCTCAAGG + Intergenic
1116383281 14:44298293-44298315 TCATGGGGGTGGATCCCTCATGG - Intergenic
1116438039 14:44915870-44915892 TCATGACAGTGGAGCCCTCCTGG + Intergenic
1116439687 14:44937914-44937936 TCAAGAGGGTGGATCCTTCAGGG + Intronic
1116439985 14:44940214-44940236 TCATGAGAGCAGAGCCCTCATGG + Intronic
1116748500 14:48851593-48851615 TCATGAGGGTAGACCCCTCATGG + Intergenic
1117080899 14:52150906-52150928 TAGAGAGGGTGAATCCCTCAGGG + Intergenic
1117141559 14:52795142-52795164 TTAAGAGGGTGAGGCCCTTAAGG + Intergenic
1117364530 14:55012810-55012832 TCATGAGGCCAGAGCCCTCATGG + Intronic
1117477516 14:56111507-56111529 TCATGGGGGCAGAGCCCTCATGG + Intergenic
1117538096 14:56720800-56720822 TCCTGAAGGTCAAGCCCTTAAGG + Intronic
1117637670 14:57762618-57762640 TCATAAGGGCAGAGCCCTCATGG - Intronic
1117819786 14:59636243-59636265 TCATGGAGGTGGATCCCTCATGG + Intronic
1117888519 14:60391943-60391965 TCTTGGGGGTGGATCCCTCAAGG + Intergenic
1117950006 14:61073352-61073374 TGAGGAAGGTGGAGCCCTCATGG + Intronic
1118050898 14:62026519-62026541 TCAGGAAGGAGGAGCCCTCATGG + Intronic
1118240331 14:64050260-64050282 TCATGAGGGTGGAGCCCCTAAGG - Intronic
1118700175 14:68425395-68425417 TCATGAGGGCAGGGCCCTCATGG - Intronic
1119277304 14:73370158-73370180 TCATGTGGGCAGAGCCCTCATGG - Intronic
1119277469 14:73371698-73371720 TCAGGAGGGAGTAGCCCTCCTGG - Intronic
1119556637 14:75558460-75558482 TCATGAGGACAGAGCCCTCATGG - Intergenic
1119609151 14:76047082-76047104 CCCTGAGGGTGGAGTCCTCATGG + Intronic
1119934751 14:78581467-78581489 TCACGAGGGTTCTGCCCTCATGG + Intronic
1120072675 14:80121484-80121506 TCATGAGGGATTTGCCCTCATGG - Intergenic
1120106952 14:80506936-80506958 TCATGGAGGTGGATCCCTCATGG + Intronic
1120448421 14:84632514-84632536 TAATGCGGATGAAGTCCTCATGG - Intergenic
1120471619 14:84932955-84932977 TCATGAGTGTGACTCCCTCAAGG - Intergenic
1120641028 14:87012943-87012965 TCATGAGGATGAAGCCCTCATGG + Intergenic
1120831318 14:89000051-89000073 GCATGAGGGTGAAGCCAACATGG + Intergenic
1120865505 14:89292522-89292544 TCATGAGGAAGGAGCCCTCCTGG - Intronic
1120924650 14:89785531-89785553 CCACGAGGGTGGAGCCCTCATGG - Intergenic
1121152361 14:91647275-91647297 TCGTAAGGGTAGAGCCCTCAGGG + Intronic
1121462906 14:94095748-94095770 TCATGGGGGAAAATCCCTCATGG - Intronic
1121597332 14:95174459-95174481 ACATGAGGATGCTGCCCTCAAGG - Intergenic
1121630609 14:95419170-95419192 TCAGAAGAGTGAGGCCCTCATGG + Intronic
1121875747 14:97449980-97450002 TCATGACGGTGGAGTCTTCAGGG + Intergenic
1122086363 14:99309394-99309416 TCATGGGGGTGGATCCCTCATGG + Intergenic
1122366710 14:101198686-101198708 TCAGGAGGGAAAAGCTCTCATGG - Intergenic
1122420648 14:101574598-101574620 TCATGGGGGCGGACCCCTCATGG + Intergenic
1122555223 14:102575267-102575289 TCATGAGGGCAGAGCCCTCACGG - Intergenic
1122682435 14:103475971-103475993 TCATGAAGGCGGAGCCCTCGTGG + Intronic
1122776876 14:104121047-104121069 CCATGAGGGTGGAGCACTCATGG + Intergenic
1123467652 15:20528532-20528554 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1123569065 15:21583353-21583375 TTATGGAGGTGAATCCCTCATGG - Intergenic
1123580014 15:21706450-21706472 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1123605175 15:22018674-22018696 TTATGGAGGTGAATCCCTCATGG - Intergenic
1123616662 15:22149072-22149094 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1123650462 15:22472510-22472532 AGATGAGGGAGAGGCCCTCAGGG - Intergenic
1123727963 15:23123741-23123763 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1123740870 15:23281352-23281374 AGATGAGGGAGAGGCCCTCAGGG - Intergenic
1123746128 15:23321206-23321228 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1123761647 15:23438119-23438141 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1123871956 15:24584562-24584584 TCGTGAGGGAGAAGCCAGCATGG - Intergenic
1123898699 15:24854183-24854205 TTATGAGGCTAAAGCCCTCAAGG + Intronic
1124025504 15:25961785-25961807 TTATGGGGGTGGATCCCTCATGG + Intergenic
1124278396 15:28344523-28344545 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1124304305 15:28567085-28567107 AGATGAGGGAGAGGCCCTCAGGG - Intergenic
1124431138 15:29609437-29609459 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1124532313 15:30518404-30518426 TGATGAGGGTGGGGCCCTGAGGG + Intergenic
1124533178 15:30523553-30523575 AGATGAGGGAGAGGCCCTCAGGG - Intergenic
1124736277 15:32249389-32249411 TCATGGGGGCGGATCCCTCATGG - Intergenic
1124765478 15:32484091-32484113 AGATGAGGGAGAGGCCCTCAGGG + Intergenic
1124766340 15:32489241-32489263 TGATGAGGGTGGGGCCCTGAGGG - Intergenic
1124783225 15:32655670-32655692 TTGTAAGGGTGAAGTCCTCAAGG - Intronic
1124857751 15:33407165-33407187 TCATGAGGGCTTTGCCCTCATGG + Intronic
1125043503 15:35220461-35220483 TCATGAGGGTGGAGTCATCATGG - Intronic
1125043825 15:35223329-35223351 TGATGAGGGTGGAGCTCTAATGG + Intronic
1125753638 15:42047476-42047498 TCATGAGGCTGCTGCCCTCATGG - Intronic
1125765333 15:42131755-42131777 TCATGAGGGTGGAGGCCTCATGG + Intergenic
1126185357 15:45826020-45826042 GAATGAGGGTACAGCCCTCATGG - Intergenic
1126186154 15:45832175-45832197 TCATGGGGGCGGATCCCTCATGG - Intergenic
1126243982 15:46481832-46481854 CCATGAGTGAGAACCCCTCATGG - Intergenic
1126297005 15:47150904-47150926 TCATGCGGGACAATCCCTCATGG - Intergenic
1126341329 15:47644539-47644561 TCACCAGGGAGGAGCCCTCATGG - Intronic
1126508043 15:49430774-49430796 TCAGGAGGTTGAAGCCTTCATGG + Intronic
1126570822 15:50148463-50148485 TCATGAGGGAGGAGCTCTCATGG - Intronic
1127284125 15:57517769-57517791 TCATAAGGGCAGAGCCCTCATGG + Intronic
1127311276 15:57754123-57754145 TCATGAGGGAGGAGCCCTCATGG - Intronic
1127909752 15:63406762-63406784 TCCTCAGGGTGGAGCCCTCATGG + Intergenic
1128056900 15:64706452-64706474 TCTAGAGGGTGAAGCCCCAATGG - Intergenic
1128086828 15:64892521-64892543 TCATGAGGGCAGAGTCCTCATGG - Intronic
1128277262 15:66364019-66364041 TCATGGGGGTGGATCCCTCATGG - Intronic
1128551745 15:68602048-68602070 TCACCAGGGAGGAGCCCTCATGG + Intronic
1129108573 15:73324555-73324577 TCACGAGGGTGGAGCCCTCGTGG + Intronic
1129168088 15:73790602-73790624 TCATGAGGGCAGAGCCCTTATGG + Intergenic
1129173659 15:73823678-73823700 TCATGGGGGTGGATCCCTCATGG - Intergenic
1129582550 15:76827962-76827984 TCATGAGAGCAGAGCCCTCATGG - Intronic
1129785999 15:78310532-78310554 TCATGAGGGTGGCATCCTCACGG + Intergenic
1129935821 15:79449581-79449603 TCATTAGGGAGGAGCCCTTATGG + Intronic
1130075659 15:80687243-80687265 TCATGGGGGCGGATCCCTCATGG + Intronic
1130331645 15:82926762-82926784 CCATGAGGGTGAAGCCCTCATGG - Intronic
1130359774 15:83172155-83172177 TCATGACAGAGAAGCCCTCAAGG - Intronic
1130422513 15:83762633-83762655 TTATGAGGGTGGAGCCTTTAGGG - Intronic
1130679044 15:85980578-85980600 TCATGGGAGTGGATCCCTCATGG - Intergenic
1130747218 15:86668128-86668150 TCATGGAGGTGAATCCCTTATGG - Intronic
1130864145 15:87917643-87917665 TCATGGGGGTGGATCCCTGAGGG + Intronic
1131365149 15:91832800-91832822 TCACAAGGGAGGAGCCCTCATGG - Intergenic
1131560210 15:93433121-93433143 TCATGAGGGTGGAGGTCTCATGG - Intergenic
1131727713 15:95244918-95244940 TCATGGGGGTGGATCCCTCATGG - Intergenic
1131740853 15:95389689-95389711 TCATGAGGGTTCTGACCTCATGG + Intergenic
1131876369 15:96811234-96811256 TCAGGAGGGAGAAGCCCTGTTGG - Intergenic
1131966773 15:97852713-97852735 TCTTGAGGGTGGAGTCCTCATGG - Intergenic
1132034375 15:98469078-98469100 CCATGAGGCTGGAGCCTTCAAGG - Intronic
1202977420 15_KI270727v1_random:310443-310465 TTATGGAGGTGAATCCCTCATGG - Intergenic
1202988884 15_KI270727v1_random:440695-440717 TCATGAGGGCAGAGCCCTCTCGG - Intergenic
1133001345 16:2853131-2853153 TCAGGGGGGTGGGGCCCTCAGGG - Exonic
1133452040 16:5911839-5911861 CCATGGGGGTGGGGCCCTCATGG - Intergenic
1133707632 16:8370261-8370283 TCATGAGGGTCGAGCTCTCATGG - Intergenic
1133836626 16:9373421-9373443 TCATGAGTGTGGGGCCCCCATGG + Intergenic
1133863978 16:9624469-9624491 TCATGGGGGTGGATCCCTCATGG + Intergenic
1134647529 16:15882018-15882040 TCATGGGGGTGGATCCCTCATGG + Intronic
1134898683 16:17914530-17914552 TCATGAGGGTAAAGCCCTAACGG + Intergenic
1134909938 16:18016319-18016341 TTATGAGGGCAGAGCCCTCATGG + Intergenic
1135474707 16:22763857-22763879 GCAGGAGGGGGAAGCCCTGATGG - Intergenic
1135492894 16:22925265-22925287 CCCTGAGGGTGGAGCCCTCGTGG - Intergenic
1135499166 16:22978867-22978889 TCATGAGAGTGGAGCCCTCATGG - Intergenic
1136466654 16:30448804-30448826 TGCTGAGGCTGCAGCCCTCAGGG - Intergenic
1136664653 16:31799253-31799275 TCATGAGGATGGTGCCCTCCTGG + Intergenic
1137014384 16:35359488-35359510 TCATGAGAGTAGAGCCCTCATGG - Intergenic
1137284632 16:47004994-47005016 TCATGAGGATGAAGCCCTCAGGG - Intergenic
1137460715 16:48660366-48660388 TCATGGGGGTGGACACCTCATGG + Intergenic
1137627119 16:49916217-49916239 TCACGGGGGTGAATCCCTCGTGG + Intergenic
1137932247 16:52600129-52600151 TCATCAGGGCAGAGCCCTCACGG + Intergenic
1138039717 16:53650174-53650196 TCATGAGGGTGGATCCCTCGTGG - Intronic
1138309153 16:56008545-56008567 TGCTGGGGTTGAAGCCCTCAGGG - Intergenic
1138578389 16:57923337-57923359 TGATGAGGCTGAAGAGCTCAAGG - Exonic
1138696821 16:58821653-58821675 TCAAGAGGGAGGAGCCCTCATGG + Intergenic
1138747769 16:59383415-59383437 TCATGAGGGCAGAGTCCTCATGG + Intergenic
1138753106 16:59447927-59447949 TCATGAGGATGGAGCACTCATGG - Intergenic
1138965807 16:62082710-62082732 TCATAAGGGTGGATCCCCCAAGG + Intergenic
1138969455 16:62127433-62127455 TCATGAGGGTGGAGCCCTCATGG - Intergenic
1139252852 16:65512764-65512786 TCATGATGGTGGATCCTTCATGG - Intergenic
1139339304 16:66257581-66257603 TCATGGGAGTGGACCCCTCATGG + Intergenic
1139644136 16:68315565-68315587 TCATCTAGGTGCAGCCCTCAAGG - Intronic
1140374803 16:74436611-74436633 TCATAAGGTTGGAGCCCTCATGG + Intergenic
1140467156 16:75191679-75191701 TCATGAGGGAGGACACCTCATGG - Intergenic
1140690538 16:77479167-77479189 TCATGAAGGTCAAACCCTCGTGG - Intergenic
1140752571 16:78039323-78039345 TCATGAGGGCAGAGCTCTCATGG + Intronic
1140931918 16:79635692-79635714 TCATGACTGTGAACTCCTCAAGG - Intergenic
1141069670 16:80942265-80942287 TCATGGGGGTGGATCCCTCATGG + Intergenic
1142633952 17:1245088-1245110 ACACAAGGGTGAAGCCCTCCTGG + Intergenic
1142929658 17:3272018-3272040 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1143717770 17:8787010-8787032 TCATGAGGATGCTGCCATCATGG - Intergenic
1143991301 17:10964697-10964719 TCATGGGGGTGGATCCCTAATGG + Intergenic
1143992820 17:10981105-10981127 CCATGAGAATGGAGCCCTCATGG + Intergenic
1144048332 17:11473536-11473558 CCATGAGGGTGGAGCCCTCATGG + Intronic
1144064756 17:11614834-11614856 TCATGAGGGAGAAGCTCTCATGG + Intronic
1144189779 17:12833901-12833923 TCATGCGGGTGAAACCTCCAGGG + Intronic
1144483058 17:15643331-15643353 TCATGTGGGTAAAGCCTCCAGGG - Intronic
1144915623 17:18721699-18721721 TCATGTGGGTAAAGCCTCCAGGG + Intronic
1145102533 17:20088843-20088865 TCATGAGGGTGAAGCCCTCATGG - Intronic
1146549101 17:33764703-33764725 TCTTGAGGGTACAGCCCTTATGG + Intronic
1146567675 17:33927402-33927424 TCATGAGAATGTAACCCTCATGG - Intronic
1146579394 17:34023549-34023571 TCATGAGGGAGGGGCTCTCATGG - Intronic
1146784993 17:35711930-35711952 TCAGGAGACTGAAGCCCTCCTGG + Intronic
1148560803 17:48604922-48604944 TCAAGAGGCTGGAGCCCTGAAGG + Exonic
1148919610 17:51019021-51019043 TTATAAGGGAGAAGCCCTTATGG - Intronic
1149048765 17:52279468-52279490 TCATGGGGGAGGATCCCTCATGG + Intergenic
1149060280 17:52413484-52413506 TCATGAGGGTGGAGGTATCATGG - Intergenic
1149062075 17:52434377-52434399 CCATGAGGGTGGAGCTCTCACGG + Intergenic
1149216843 17:54366168-54366190 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1149401010 17:56295886-56295908 TCATGAGGGTGGAGGCCTCATGG + Intronic
1149440938 17:56673346-56673368 TCATGAGGGGAGAGCCCTCATGG + Intergenic
1150492871 17:65586529-65586551 TCATGAGGATGGGGCCCTCATGG - Intronic
1150545640 17:66154903-66154925 TTATGAGGGCAAAGCCTTCATGG - Intronic
1150583245 17:66494506-66494528 CCCTGAGGGCAAAGCCCTCATGG + Intronic
1150668571 17:67169515-67169537 TCATGAGGGTGGAATCCTCATGG + Intronic
1150686884 17:67328041-67328063 TCATGAGGGCACAGCCCTCATGG - Intergenic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1151375699 17:73687286-73687308 TCATAGGGGTGGATCCCTCATGG + Intergenic
1151880169 17:76889926-76889948 TCATGATCAGGAAGCCCTCAGGG - Intronic
1151971542 17:77460040-77460062 TCATGGGGGTGGATCCCTCATGG - Intronic
1152300576 17:79493258-79493280 TCATGGGGGCGGATCCCTCATGG - Intronic
1152477116 17:80525662-80525684 TCACGAGGGTGGAGACTTCACGG - Intergenic
1152735586 17:81995446-81995468 TCCTGAGGCTGTGGCCCTCAGGG + Intronic
1152918672 17:83054704-83054726 TCATGAGAGGACAGCCCTCACGG - Intergenic
1153386134 18:4498913-4498935 ACATGTTGGTGAAGCCATCATGG - Intergenic
1153453196 18:5252415-5252437 TTATGATGGTGTATCCCTCATGG + Intergenic
1153549051 18:6241901-6241923 TCCTGAGGGTGCAGCCATCCAGG + Intronic
1153903033 18:9635969-9635991 TCATGGGGGTGGATTCCTCATGG - Intergenic
1153954007 18:10080746-10080768 TCGTGGGGGTGGATCCCTCATGG + Intergenic
1154246430 18:12703140-12703162 TTAGGAGGGTGAAGCCGGCAAGG - Exonic
1154285001 18:13046276-13046298 TCATAGCGGTGAACCCCTCATGG - Intronic
1154287486 18:13073767-13073789 GCATGGGGCTGGAGCCCTCATGG + Intronic
1154378197 18:13826223-13826245 TCATGACGGCGAGGCGCTCAGGG + Exonic
1155026676 18:21946995-21947017 TCATTAGGGCAGAGCCCTCATGG - Intergenic
1155324154 18:24649351-24649373 TCATGAAGGAGGAGCCCTCATGG + Intergenic
1155444168 18:25893394-25893416 TCATGAGTGTGTATTCCTCAAGG - Intergenic
1155449694 18:25950742-25950764 TCATGAGGGTGAATCCTTCCTGG - Intergenic
1155624565 18:27819674-27819696 TCATGAGGGCTCTGCCCTCATGG - Intergenic
1155683166 18:28514803-28514825 TCATGGGGGTGGATCCCTCAAGG + Intergenic
1156018112 18:32569214-32569236 TCATGATGGCAGAGCCCTCATGG + Intergenic
1156162551 18:34376943-34376965 TCATAAGAGTGGAGCCCTCATGG - Intergenic
1156619578 18:38833494-38833516 CCATAAGGGTAGAGCCCTCATGG - Intergenic
1157151983 18:45227562-45227584 TAATGAGGGAGGAGCCCTCCTGG + Intronic
1157323671 18:46654064-46654086 TCACGAGGGGGAAGCTCTCATGG - Intronic
1157440276 18:47706247-47706269 TCATGGGCGTGAATCCCTTATGG - Intergenic
1157623248 18:49028082-49028104 TCATGGGGGCGGATCCCTCATGG - Intergenic
1157779349 18:50423668-50423690 TCATTGGGGTGGATCCCTCATGG + Intergenic
1157781511 18:50444038-50444060 TCATGAGGGTGGAGCCCTCATGG + Intergenic
1157946249 18:51984059-51984081 CCATGAGGGTGGAGCCTTCATGG + Intergenic
1158048510 18:53186981-53187003 TCATGAGGGTAGAGCCCTCATGG + Intronic
1158180998 18:54714787-54714809 TCATGAGGGTAGAGCGCTAATGG - Intergenic
1158429826 18:57375378-57375400 TCATGAAGGTAGAGACCTCATGG + Intergenic
1158485073 18:57858982-57859004 TCATGAGGGTGGAGCCCTCATGG + Intergenic
1158517679 18:58144431-58144453 TCATGGGGGTGGATCCCTCATGG - Intronic
1158992051 18:62879189-62879211 TCATGAAGGTAGAGCCCTCATGG - Intronic
1159505828 18:69333920-69333942 TCCTGGGGGTGAATCCCTCCGGG + Intergenic
1159695471 18:71551991-71552013 TCATGAGGTTGAGTCCCCCATGG + Intergenic
1160272942 18:77404019-77404041 TCACGAGGATGGATCCCTCATGG - Intergenic
1160291949 18:77603058-77603080 TCATGGGGGTGGATCCCTCATGG - Intergenic
1161106694 19:2447285-2447307 TCATGAGTGTGACATCCTCAAGG - Intronic
1161610172 19:5237982-5238004 TCATGATGGTCAAACCTTCAAGG - Intronic
1163035204 19:14565757-14565779 TCATCTGGGTGAAGCCCACCAGG - Exonic
1163196994 19:15728847-15728869 TCAGGAGGGTGACACCCTGATGG + Exonic
1163219075 19:15901397-15901419 TCATGGGGGCGGATCCCTCATGG + Intergenic
1164511342 19:28899676-28899698 TTATGAGAGTGGAGCCCTCATGG + Intergenic
1164530376 19:29043922-29043944 TCATGGGGGTGGATCCCTCATGG - Intergenic
1164807870 19:31130761-31130783 TTGTGAGGGAGGAGCCCTCATGG + Intergenic
1165202963 19:34160063-34160085 TCATGAGGGTCAAGCCCTCATGG + Intergenic
1165251943 19:34545982-34546004 TCATGACGGCAGAGCCCTCAAGG - Intergenic
1165268494 19:34682176-34682198 TCATGAGGGCAGAGTCCTCAAGG + Intronic
1165274708 19:34738387-34738409 TCATGAGGGCAGAGCCCTCAAGG + Intronic
1165276046 19:34752494-34752516 TAAGGAGGGTGAAGGCCTCGGGG - Intergenic
1165308768 19:35018424-35018446 TCATGGGGGCGGATCCCTCATGG - Intronic
1165642022 19:37397781-37397803 TCATAAGGGCAAAGTCCTCATGG - Intergenic
1167577316 19:50323998-50324020 TAATATGGATGAAGCCCTCATGG + Exonic
1168452980 19:56480241-56480263 TCAGGAGAGTGAAACCATCATGG - Intergenic
925229112 2:2215903-2215925 TCATAGGGGTGGATCCCTCATGG + Intronic
925383764 2:3447575-3447597 TCCTGGGGGTGGATCCCTCATGG - Intronic
925498673 2:4480711-4480733 TCATGGGGGTGGATTCCTCATGG - Intergenic
925767592 2:7251639-7251661 TCATGAGGGAGGAGCTCTCATGG - Intergenic
926373813 2:12206729-12206751 TCATGGGGGTGGATTCCTCATGG + Intergenic
926493829 2:13559009-13559031 TCATGGGGGTGGATCCTTCATGG - Intergenic
926666309 2:15527606-15527628 TCATGAGGGAGAAGTCCTAACGG + Intronic
926784128 2:16503330-16503352 TCAAGAGGGTAGAGCTCTCATGG + Intergenic
926814955 2:16791185-16791207 CCGTGAGGGTGAATTCCTCATGG - Intergenic
926911085 2:17852904-17852926 TCTTTAGGGTGAAGACCTCCAGG - Intergenic
926982989 2:18591360-18591382 TCATGAAGGTCAATCCCTAATGG - Intergenic
927091027 2:19712839-19712861 TCATGGGGGTGGATCTCTCATGG - Intergenic
927128912 2:20040074-20040096 TCATAAGGGTAGAGCCCTCATGG + Intronic
927288950 2:21385934-21385956 TCATGAGGGTGGATCTCTCATGG + Intergenic
927359947 2:22221508-22221530 TCCTGAGAGTGGAACCCTCATGG + Intergenic
927370982 2:22355036-22355058 TTATGAGGGTGAAGTCCTCATGG + Intergenic
927928754 2:27030763-27030785 TCATGGTGGTGGATCCCTCATGG - Intergenic
927943549 2:27120856-27120878 TCATGAGGGGAGAGCCCTCATGG - Intergenic
928068479 2:28190717-28190739 TCATGAGGGCTCTGCCCTCATGG - Intronic
928620316 2:33082102-33082124 TCATGAGGACGAAACCCTCACGG - Intronic
928764139 2:34621716-34621738 TCATGAGAGTAGAACCCTCACGG + Intergenic
929018914 2:37530895-37530917 TCATGAGGGCTCTGCCCTCATGG + Intergenic
929255141 2:39802458-39802480 TCATGGGGGTGGATCCCTAATGG - Intergenic
929257039 2:39823273-39823295 TCATGAGGGAGGAGTTCTCATGG + Intergenic
929407212 2:41656524-41656546 TCATGGGGGCGGATCCCTCATGG + Intergenic
929812102 2:45199433-45199455 CTATGAGGGTGGAGCCCTCATGG - Intergenic
929941587 2:46338026-46338048 TCTTGAGGGTGAAGCCTTCTAGG - Intronic
930118458 2:47740173-47740195 TCTTGGGGGTGGATCCCTCATGG - Intronic
930122337 2:47770138-47770160 CCAGGAGGGCCAAGCCCTCATGG - Intronic
930146616 2:48013662-48013684 TGATGAGGTTAGAGCCCTCATGG - Intergenic
930746863 2:54893468-54893490 TCATGAGGGCAGACCCCTCATGG + Intronic
930886862 2:56335934-56335956 CCATGAGGGTGGAGCCCTCATGG + Intronic
930991843 2:57665650-57665672 TTATGAGGGAGGAGCCCTCATGG - Intergenic
931115405 2:59161385-59161407 TCACCAGGGAAAAGCCCTCATGG + Intergenic
931269623 2:60689885-60689907 TCATGAGGAAGAAGCCCCCATGG - Intergenic
931289801 2:60862415-60862437 TCATGGGGGTGGATCCCTCAAGG - Intergenic
931290506 2:60869104-60869126 TCATAAGGGTGGTGCCTTCATGG - Intergenic
931472959 2:62557651-62557673 TCATGGGGGTGGATTCCTCATGG + Intergenic
931544909 2:63372198-63372220 TCATGAGGGTGGATGCCTTATGG + Intronic
931815873 2:65900001-65900023 TCATGAGGGTGGAGCCCTTATGG + Intergenic
931955276 2:67417434-67417456 CCATGAGGGTGGAGCCCTCATGG + Intergenic
932005738 2:67925305-67925327 TCATGGGGGAGGATCCCTCATGG - Intergenic
932071210 2:68622256-68622278 TTATCAAGGTGCAGCCCTCATGG + Intronic
932588699 2:73049585-73049607 TCATGAGGGAGGGACCCTCATGG + Intronic
932878070 2:75474032-75474054 TAATGAGGAAGGAGCCCTCATGG + Intronic
933198935 2:79425597-79425619 TCACAAGGGAGAAGCCCTCATGG + Intronic
933318880 2:80747056-80747078 TCATGGGGGTAGATCCCTCATGG + Intergenic
933578936 2:84103281-84103303 TCATGAGGAGGAAGCACTGATGG - Intergenic
933583576 2:84154938-84154960 TCATGGGGGTGGATCCTTCATGG + Intergenic
933605620 2:84379319-84379341 TCATTATGGTGGAGCCCTCATGG - Intergenic
933736243 2:85497060-85497082 TCAGAAGGGTGAAGGCCTCCTGG - Intergenic
933850784 2:86364945-86364967 TCATGAGGGCAGATCCCTCATGG - Intergenic
934158688 2:89227630-89227652 TCATGGGGGTGCATCCCTCATGG + Intergenic
934208586 2:89954797-89954819 TCATGGGGGTGCATCCCTCATGG - Intergenic
934486134 2:94713124-94713146 TCATGAGGGAGGATCTCTCATGG - Intergenic
934546930 2:95225501-95225523 CCACAAGGGTGAAGCCCTCATGG + Intronic
934569612 2:95360826-95360848 TCGTGAGGGTGGGGCCCTCATGG + Intronic
934611397 2:95739564-95739586 TCATGGGGGTGGATCCCTCATGG + Intergenic
934695448 2:96396855-96396877 TCATGAGAGTGGAGGCCTCATGG + Intergenic
935167831 2:100585131-100585153 TCATGGGGGTGGATCCCTCATGG + Intergenic
935272593 2:101448069-101448091 TCATGAGGGTGGAGGCTTCATGG + Intronic
935300359 2:101688425-101688447 TCATGGGGGTGGATCCCTCATGG + Intergenic
935416139 2:102821341-102821363 TCATGAGGGTGGATCCTTCATGG + Intronic
935715827 2:105938102-105938124 TCATGGGGGTGGATCCCTCATGG + Intergenic
935887825 2:107642936-107642958 TCATGAGGGTAAGGCCCTCATGG + Intergenic
936168694 2:110148172-110148194 TCATGAGGGCAGATCCCTCATGG + Intronic
936248019 2:110845326-110845348 TCGTGAGGGAGGAGCCCTCATGG + Intronic
936592712 2:113819398-113819420 TCATGAGGGTAGAGCCCTCATGG - Intergenic
936596875 2:113856613-113856635 TCATGAGGAAGGAGCCCTCATGG - Intergenic
936785025 2:116084536-116084558 TCATAAGGGGGCAGCCCTTATGG + Intergenic
937139141 2:119583753-119583775 TCATGAGGGCTTTGCCCTCATGG - Intronic
937331659 2:121034397-121034419 TCATGAAGGTGAAGCTCTCATGG - Intergenic
937420271 2:121748309-121748331 TCATGAGGGGATAGCTCTCATGG + Intronic
937434591 2:121869972-121869994 ACAGCAGGGTGAAGACCTCAAGG - Intergenic
937449011 2:121985040-121985062 CTGTGAGGGTGGAGCCCTCATGG + Intergenic
937476132 2:122217016-122217038 TCTTGCGGGTGAAGCCCTCATGG + Intergenic
937550708 2:123086658-123086680 TCATGGGAGTGGATCCCTCATGG + Intergenic
937788045 2:125925295-125925317 TCCTGAGGGTTAAGCCCACTCGG - Intergenic
937797616 2:126042466-126042488 TCATGAGGGTGGAGTCCTCATGG + Intergenic
938569793 2:132552282-132552304 TCATGGGGGCGGATCCCTCATGG + Intronic
938704082 2:133905286-133905308 TCACAAGGGAGAAGCCCTCATGG + Intergenic
938757169 2:134391601-134391623 TCACAAGGGTGAAGTCCTCATGG - Intronic
938927538 2:136057982-136058004 TCAGGAGGGCAGAGCCCTCATGG + Intergenic
939075941 2:137602744-137602766 TCATGAGAGTGGAGTCCCCATGG + Intronic
939248417 2:139655349-139655371 TCATGAGGGAGGAGCCCTCATGG - Intergenic
939256563 2:139751188-139751210 TTGTGAGGGTGGGGCCCTCATGG - Intergenic
939259140 2:139784257-139784279 TCATGGGGGAGGATCCCTCATGG - Intergenic
939284946 2:140116535-140116557 CCATGAGGCTGGAGTCCTCATGG + Intergenic
939371673 2:141309494-141309516 TCATGAGAGTGGAATCCTCATGG - Intronic
939552866 2:143637063-143637085 TCATGAGGGTGGGGCTCTCCTGG - Intronic
939834489 2:147112011-147112033 TCATGGGGGTGGATCCCTCATGG + Intergenic
939852948 2:147321531-147321553 GCATTGGGGTGGAGCCCTCATGG + Intergenic
939967832 2:148627903-148627925 TCAGGAGGGTACAGCCCTCATGG - Intergenic
940093080 2:149943907-149943929 TCTTGAGGGCAAAGCCCTCATGG + Intergenic
940155700 2:150653990-150654012 TCATGAGGGTTCCACCCTCATGG - Intergenic
940174422 2:150863034-150863056 TCATGAGGGAGGAGCCTTCATGG + Intergenic
940322599 2:152392644-152392666 TCGAGAGGGAGAAGCCATCATGG + Intronic
940507184 2:154570662-154570684 TCATGTGGGCGGATCCCTCATGG + Intergenic
940521632 2:154757868-154757890 TCATGAGGGTAGAGCCCTCATGG + Intronic
940596170 2:155795677-155795699 GCTGGAGGGTGGAGCCCTCATGG - Intergenic
940644554 2:156377058-156377080 TCATGAGAGTGGAGGTCTCATGG + Intergenic
940667060 2:156621660-156621682 TCATTAGGGTAGAGCCCTCATGG - Intergenic
940682772 2:156807177-156807199 TCATGAGGGCAGAGCCCTTATGG - Intergenic
940941965 2:159571901-159571923 TCATAAGGGTGGAGCCCTTGTGG + Intronic
941006320 2:160250903-160250925 TCACGAGGGTAGAGCCCTCATGG - Intronic
941723516 2:168837107-168837129 TCATGAGGGTTCCACCCTCATGG + Intronic
942296794 2:174525294-174525316 TTGTGAGGGAGAAGCCCTCATGG + Intergenic
942489613 2:176476331-176476353 TCATGAGGGAAGAACCCTCATGG + Intergenic
942513072 2:176723212-176723234 TCATGAGGGTAGAGACCTCATGG - Intergenic
942750615 2:179282794-179282816 TCATGAAGGCAGAGCCCTCATGG - Intergenic
943004923 2:182377208-182377230 TCATGAGGGTGGCTCCCTCCTGG + Intronic
943107327 2:183561616-183561638 TTCTGAGGGTGAAGCCCTCATGG + Intergenic
943113670 2:183639390-183639412 TCCTGTGGGTGCAGCCCACAGGG - Intergenic
943119644 2:183719213-183719235 TCATGAGGGTGGAGCCCTCATGG + Intergenic
943195614 2:184744416-184744438 TCATGAGGGTTGCACCCTCATGG - Intronic
943644840 2:190399145-190399167 CCATGAGGGTGGAACCTTCATGG + Intergenic
943753160 2:191531147-191531169 TCATGGGAGTGGATCCCTCATGG - Intergenic
943876290 2:193071777-193071799 TCTTGGGGGTGGATCCCTCATGG + Intergenic
943911459 2:193573177-193573199 TCATGAGGGTGCAGCACTCATGG - Intergenic
944097829 2:195989683-195989705 TCATGGGGGTGGATTCCTCATGG + Intronic
944187721 2:196967883-196967905 TCATTGGGGTGGATCCCTCATGG + Intronic
944650348 2:201823698-201823720 TTATGAGGATGAAGCCCTCCTGG - Exonic
944803520 2:203259374-203259396 TCATGGGAGTGGAGTCCTCATGG + Intronic
945164916 2:206933035-206933057 TTATGAGGGTGGAGCCCTCATGG - Intergenic
945182751 2:207108469-207108491 TCAAAAGAGTGGAGCCCTCAGGG + Intronic
945543430 2:211118846-211118868 TCATGAGGGAAGAACCCTCATGG - Intergenic
945672533 2:212819546-212819568 TCATAAGGGTAGAGCCCTCAGGG - Intergenic
946113246 2:217438434-217438456 TCATGAGGGTGGAGCCTTCATGG + Intronic
946126337 2:217566329-217566351 TCATAGGGGTGAAGTTCTCATGG - Intronic
946187788 2:217990985-217991007 TCAAGAAGGTGAAGCCCTGTGGG - Intronic
946221687 2:218232946-218232968 TCATGAGGGCAGAGCCCTCATGG + Intronic
946500924 2:220246246-220246268 TCATGAACGTGGGGCCCTCATGG + Intergenic
946936524 2:224726999-224727021 TCATGGGGGTGGATCCCTCATGG + Intergenic
947113726 2:226747355-226747377 TCATGAGGGTGGAGCCCTCATGG + Intronic
947895197 2:233664688-233664710 TCATGGGGGTGGATCCCTCATGG - Intronic
947957598 2:234207070-234207092 TCCTGAGGAAGGAGCCCTCATGG + Intergenic
948180741 2:235978091-235978113 TCATGAAGGCCCAGCCCTCATGG + Intronic
948222650 2:236285254-236285276 TCATGAGGAAGGAGCCCTCGCGG - Intergenic
948244226 2:236464733-236464755 TCATGGGGGTGGATCCCTCATGG + Intronic
948383806 2:237569051-237569073 TCATGAAGGTGGAACCCTCATGG - Intergenic
948898455 2:240941864-240941886 TGATGAGGGTGGAACCCTTATGG - Intronic
1169414505 20:5404643-5404665 TCATGGGGGTGGATCTCTCATGG - Intergenic
1169467218 20:5851913-5851935 CCATGAGGGTGGATCCCTCATGG + Intronic
1169601645 20:7267814-7267836 TCATGAGGATGGAGCCCTCATGG + Intergenic
1169907172 20:10615914-10615936 TCATGAGGGTGGAGCCCTCATGG + Intronic
1170085212 20:12524128-12524150 TCATGAGGTTAGAGCCCTCATGG - Intergenic
1170372729 20:15667144-15667166 CCATCAGGGTGGATCCCTCATGG + Intronic
1170421376 20:16196786-16196808 TCATGAGGATGGAGCCCTCATGG - Intergenic
1170717351 20:18843554-18843576 TCATGGGGGCGGATCCCTCATGG - Intergenic
1170742072 20:19066868-19066890 TCATGAGGGTTCTGCCCTCACGG + Intergenic
1170749740 20:19134939-19134961 TCATGAGGGTGAAGCCTTAATGG + Intergenic
1170896155 20:20416322-20416344 TCATGAGGGTGTAGCCTAAAGGG - Intronic
1171015155 20:21534089-21534111 CCAAGAGAGTGGAGCCCTCATGG - Intergenic
1171157913 20:22893493-22893515 TCATGGGGGCGTATCCCTCATGG + Intergenic
1171318260 20:24215056-24215078 TCACAAGGGAGCAGCCCTCACGG - Intergenic
1171336049 20:24386506-24386528 TCATGAGGGCAGAGTCCTCATGG - Intergenic
1171395625 20:24831093-24831115 TCATGAGGGTGGGGCCCTCATGG + Intergenic
1171421097 20:25018164-25018186 TCATGAGGGTGGAAACCTCTTGG - Intronic
1171451439 20:25238705-25238727 CCATAAGGGTGCAGCTCTCATGG - Intergenic
1171452195 20:25243926-25243948 CCTTGAGGGTGGAGGCCTCATGG + Intergenic
1171752882 20:29071742-29071764 TCATGGAGGTGGATCCCTCATGG - Intergenic
1171789382 20:29505824-29505846 TCATGGAGGTGGATCCCTCATGG + Intergenic
1171858152 20:30368617-30368639 TCATGGAGGTGGATCCCTCATGG - Intergenic
1171858548 20:30373396-30373418 TCATGGGGGTGGATCTCTCATGG + Intergenic
1172875710 20:38163210-38163232 TCAGGATGGGGAAGCCCTTAAGG + Intronic
1173039069 20:39443168-39443190 TCACTAGGGAGGAGCCCTCATGG + Intergenic
1173048851 20:39539610-39539632 TCATGAGGGTAGATCCCTCAAGG + Intergenic
1173593743 20:44245708-44245730 TCATGGGGGTGGACCCCTCTTGG - Intergenic
1174285851 20:49472712-49472734 TCATGGGGGTGGATCCCTCACGG + Intronic
1175016967 20:55801961-55801983 TCTTGAGGATGAAGCCATCCTGG - Intergenic
1175334154 20:58184280-58184302 GCATGAGAGTGAAGCCATCTCGG - Intergenic
1175702543 20:61150682-61150704 TCATGAGGGTAGAGCCCTCATGG - Intergenic
1176727341 21:10449880-10449902 TCATGGGGGCAAATCCCTCATGG - Intergenic
1177167712 21:17621596-17621618 TCATGAGAGAGGAGCCCTCATGG - Intergenic
1177204451 21:17995077-17995099 TCATGATGCTGCAGCCCTCTGGG + Intronic
1177206195 21:18014579-18014601 TCATCAGGGTGGATCCTTCATGG + Intronic
1177206717 21:18018395-18018417 TCATGGGGGTGAATCCCTCATGG + Intronic
1177211550 21:18077586-18077608 TCATGGGGATGAAGCTTTCACGG + Intronic
1177278842 21:18951967-18951989 TCATGACGATGGAGCCATCATGG - Intergenic
1177310326 21:19384036-19384058 TCATGAGGGAGGACCCCTCATGG - Intergenic
1177337750 21:19754743-19754765 TTATGAGGGTGGATCTCTCATGG + Intergenic
1177500575 21:21949677-21949699 TCATAAGGGTGGAGCCCCTATGG - Intergenic
1177518071 21:22180421-22180443 TCATGAGGGTGAATCCCTTATGG - Intergenic
1177535294 21:22419473-22419495 TCCTGAGGGTTAAGCTCTCATGG + Intergenic
1177682729 21:24393801-24393823 CCATGAGGGTGGAGCCATCATGG + Intergenic
1177924701 21:27199571-27199593 TCTTGGGGGTGGAGCCCTCATGG + Intergenic
1177957465 21:27617154-27617176 TTATTAGGGAGAAACCCTCATGG - Intergenic
1178023935 21:28443421-28443443 ATGTAAGGGTGAAGCCCTCATGG - Intergenic
1178029089 21:28504634-28504656 TCTTGGGGGTGGATCCCTCATGG - Intergenic
1178036287 21:28586877-28586899 TCATAAGGGCAGAGCCCTCATGG - Intergenic
1178268259 21:31165405-31165427 TCATGAGGGTGGGGTCCCCATGG + Intronic
1178415350 21:32400436-32400458 TCATCAGGGTAGATCCCTCATGG + Intergenic
1178422732 21:32455351-32455373 TCATAAGGGTGAAGACCTGATGG + Intronic
1178435347 21:32553258-32553280 TGATTAGGGTGAAGCCCTCATGG + Intergenic
1179076558 21:38127849-38127871 TCATGATGGTGGAGCCATCATGG - Intronic
1179097686 21:38330200-38330222 TCATGATGGTGAAGCCTTCATGG + Intergenic
1179097977 21:38332623-38332645 TCTTGAGGGTGGAGCCCTCGTGG + Intergenic
1179139302 21:38710135-38710157 TCATGAAGGTGGAGCCGTCATGG - Intergenic
1179227923 21:39472371-39472393 TCATGAGGGTGGTCCCCTTATGG + Intronic
1179432392 21:41332055-41332077 TGATGAGGGTGCATGCCTCATGG + Intronic
1180239608 21:46492627-46492649 TCATGAGGGTGGGGCCCTCACGG + Intronic
1180287058 22:10757145-10757167 TCATGGGGGCAAATCCCTCATGG + Intergenic
1180298347 22:10965283-10965305 TCATGGGGGTGGATCTCTCATGG - Intergenic
1180409677 22:12593801-12593823 TCATGGAGGTGGATCCCTCATGG - Intergenic
1181450970 22:23020437-23020459 CCATGAGGATAGAGCCCTCACGG - Intergenic
1181459511 22:23077944-23077966 GCATGAGGGCCAAGCCCTCATGG - Intronic
1181762207 22:25066480-25066502 TCATGAGGGTGGAGCTGTCATGG + Intronic
1182041362 22:27241220-27241242 TCATGAGGATTGAGTCCTCATGG + Intergenic
1182458044 22:30464868-30464890 TCATGAGGTTGTAGCCCACAGGG + Exonic
1182765684 22:32756598-32756620 TCATGGGAGTGGATCCCTCATGG + Intronic
1182866610 22:33609770-33609792 TCATGGGGGCGGATCCCTCATGG + Intronic
1183199416 22:36375509-36375531 TGGTGAGGGTGGAGGCCTCAAGG + Intronic
1183261049 22:36796232-36796254 ACATGGGAGAGAAGCCCTCATGG - Intergenic
1183373944 22:37451647-37451669 CCATGAGGGTGGAGCCCTTCTGG + Intergenic
1183705601 22:39473474-39473496 CCATGAGGGTGGAGCCCTCACGG + Intronic
1184447652 22:44559650-44559672 TCATGGGGGTGGATCCCTTATGG - Intergenic
1184501616 22:44878144-44878166 TCATGAGGAAGGAGCCCTCAGGG + Intergenic
1184811892 22:46841210-46841232 TCATGAAGGTGGAGCCCTCATGG + Intronic
1184897378 22:47418536-47418558 TCATGAGAGAGCAGCCCTCATGG - Intergenic
1185209356 22:49560708-49560730 TCATGAGGGAAAAGTCCTCATGG - Intronic
1185356935 22:50378925-50378947 TCATGAGAGTGGAGCCCTCACGG - Intronic
949099520 3:127312-127334 TCAGGAGGGTGGAGCCCTCATGG + Intergenic
949232850 3:1772010-1772032 TTATGAGGGCAGAGCCCTCATGG + Intergenic
949267443 3:2174930-2174952 TCATGGGGGAGGATCCCTCATGG - Intronic
949270535 3:2211271-2211293 TCATGGGGGTGGATCCCTCATGG - Intronic
949399976 3:3656070-3656092 TCACGTGGGTGAATCCCTCATGG - Intergenic
949636269 3:5984728-5984750 TCATGAGGGAGGAGCTATCAGGG + Intergenic
949850658 3:8417134-8417156 TCATGGGGGCGGATCCCTCATGG - Intergenic
950030240 3:9847249-9847271 TCATGAGGGTGGGGCCCTTGTGG + Intronic
950308279 3:11933768-11933790 TCATGAGGGCGGGTCCCTCACGG - Intergenic
950507311 3:13403413-13403435 TCATGAGGGTGGGGCCCTCATGG - Intronic
950708540 3:14798780-14798802 TCAAGATGGTTAAGACCTCAGGG + Intergenic
950924131 3:16723275-16723297 TCATGAGGGTGGGGCCCTCATGG + Intergenic
950998277 3:17528272-17528294 GCATTAGGGTGAAGTCCTGATGG - Intronic
951086078 3:18514621-18514643 TCATGAGGGTGAAGCTCTCATGG - Intergenic
951093785 3:18604586-18604608 TCATGAGGGAGGAGCCCATATGG + Intergenic
951179287 3:19640141-19640163 TCATGTGGGTGGAGCCTTCATGG - Intergenic
951391355 3:22107920-22107942 TCATGAGGGAGGAGTCCTCACGG - Intronic
951470956 3:23055533-23055555 TCATGCGGGTGGACCCCTCATGG - Intergenic
951706625 3:25550525-25550547 TCATGAGGGTGGAGCCCTCATGG - Intronic
952016698 3:28965255-28965277 TCATGGGGGTGGATCCCTCATGG + Intergenic
952139289 3:30459955-30459977 TCATGGGGGTGAATCCCTCATGG + Intergenic
952333661 3:32386824-32386846 TCATGAGGGTGGGGCCCTCAGGG - Intergenic
953206985 3:40839808-40839830 TCATGAGGGTGGAGCCTTCATGG + Intergenic
953361426 3:42300649-42300671 TCATGAGGGAGGGGCCTTCATGG + Intergenic
953708300 3:45247692-45247714 TCGTGAGGGTGGACCCCTCATGG + Intergenic
954229297 3:49204157-49204179 TCATGAGGCTGGAGTCCTCATGG + Intronic
954953854 3:54501124-54501146 TCATGAGGGAGGAGCCCTCATGG + Intronic
955013198 3:55040181-55040203 TCATAAGGGTAGAGCCCTCATGG - Intronic
955318458 3:57958000-57958022 TCATAAGGGTGGAGCCCTCATGG + Intergenic
955692804 3:61606794-61606816 TCACCAGGGAGGAGCCCTCAGGG + Intronic
955705380 3:61722305-61722327 TCATGAGGCTGATGCCCCCGTGG + Intronic
955882791 3:63565536-63565558 TCATGAGGGAGGGGCCCTCATGG + Intronic
956004451 3:64763549-64763571 TCTTGAGGGTGGTTCCCTCATGG - Intergenic
956085434 3:65603934-65603956 TCATGAGGGTGGAACCTTCATGG - Intronic
956311197 3:67882497-67882519 TCATGAGAGAGGACCCCTCATGG + Intergenic
956367439 3:68519783-68519805 TCATGAAAGTGGAGCCCTCATGG - Intronic
956544943 3:70390643-70390665 TCATGGGGATGGATCCCTCATGG - Intergenic
957167184 3:76690357-76690379 TCATGAGAGCAGAGCCCTCATGG + Intronic
957180784 3:76875063-76875085 TTATGAGGGAGGAGCCATCATGG - Intronic
957188981 3:76981934-76981956 TGATGGGGGTGCATCCCTCATGG - Intronic
957217805 3:77344430-77344452 TCATGAGGGCTCTGCCCTCATGG - Intronic
957291694 3:78285329-78285351 TAATGAGGGAGGAGCCCTCATGG + Intergenic
957298081 3:78357595-78357617 TTAGGAGGATGGAGCCCTCATGG + Intergenic
957300137 3:78381334-78381356 TCATGAGGGTAGAACCCTCATGG + Intergenic
957372991 3:79320282-79320304 TCACGAAGGTGGAGTCCTCATGG - Intronic
957599961 3:82321200-82321222 TCATGGAGGTGAATCCCTCATGG - Intergenic
957715570 3:83926267-83926289 TCATGGGGGTGGATCCCTCATGG + Intergenic
957923495 3:86778202-86778224 TCATGAGGGCAAAGTCCTCATGG + Intergenic
957931160 3:86879997-86880019 TCATGAGGGTGGAGTCCTCATGG + Intergenic
958458523 3:94364416-94364438 TCATGAGAGTGGAGACCTCATGG - Intergenic
958686740 3:97408177-97408199 CCAAGAGGGTGTAGCCTTCATGG + Intronic
958778205 3:98510568-98510590 CCATGAGGGTGGAGCCCTCATGG - Intronic
958871151 3:99560676-99560698 CCATGAGAGTGAAGACCTCATGG - Intergenic
959448535 3:106469678-106469700 TCATGGGGGAGGATCCCTCATGG + Intergenic
959509223 3:107190650-107190672 TCATGATGGTGGAGGCCCCATGG - Intergenic
959862828 3:111235286-111235308 TTATGAGGACAAAGCCCTCAAGG + Intronic
959950306 3:112174242-112174264 TCATGGAGGTGGAGCCCCCAGGG - Intronic
960034747 3:113091173-113091195 GCATGAGGGCGGAGCCCTCATGG + Intergenic
960137555 3:114121351-114121373 CCATGAGGGCAAAGCCCTCATGG - Intergenic
960142724 3:114166419-114166441 TCATGAGGGCAGAGTCCTCAAGG - Intronic
960503680 3:118467644-118467666 TCATGGAGGTGAATTCCTCATGG - Intergenic
960503879 3:118470014-118470036 TCATGAGGGAGGATCCCTCATGG + Intergenic
961184495 3:124902783-124902805 TAATGAGGGTGGAGCCCTCATGG + Intergenic
961423850 3:126829601-126829623 TCATGAGGGTGGGGCCTCCATGG + Intronic
961436096 3:126917736-126917758 TCATGGGAGTGGAGGCCTCATGG + Intronic
961501870 3:127342052-127342074 TCGTGAGGGTGGAGCCCTCGTGG - Intergenic
961672218 3:128541557-128541579 TCATGGGGGTGGACCCCTCATGG + Intergenic
962657676 3:137565303-137565325 TCATGAGGGTGGATCGCTCATGG + Intergenic
962940818 3:140123278-140123300 TCATGAAGGCAGAGCCCTCATGG + Intronic
962960227 3:140304526-140304548 TCATGAAGGTGGGGCCCTCATGG - Intronic
963427865 3:145155301-145155323 TCATGGTGGTGGATCCCTCATGG - Intergenic
963522944 3:146378930-146378952 CCATGAGGGTGAAACAATCATGG - Intergenic
963543712 3:146627851-146627873 TCATGAGGATGAAGGTCTCATGG - Intergenic
963867549 3:150378920-150378942 TCATGAGGGCGGAGTTCTCATGG + Intergenic
963878313 3:150501162-150501184 TGGCGAGGGGGAAGCCCTCATGG - Intergenic
963905183 3:150767702-150767724 TGCTAAGGGTGTAGCCCTCATGG - Intergenic
964012205 3:151904557-151904579 TCATGAGAGTGGATCCCTCCAGG + Intergenic
964061024 3:152522890-152522912 TCATGGGGGTGGATCCCTCATGG - Intergenic
964092260 3:152891633-152891655 TCATAGGGGTGGATCCCTCATGG - Intergenic
964327748 3:155565375-155565397 TCATGGGGGTGGACCCCTCAAGG + Intronic
964491394 3:157240125-157240147 TCATAAGGGGAAAGCTCTCATGG - Intergenic
964655943 3:159066273-159066295 TCATGAGGGCAGAGCCTTCATGG - Intronic
964843873 3:161025227-161025249 TCATGAAGGAGAAGCTCTCATGG - Intronic
965342298 3:167504803-167504825 TCATGAGGGTGGATCCCTCACGG + Intronic
965465033 3:169018621-169018643 TCATGACAGTGGAGCCTTCATGG - Intergenic
965811030 3:172592073-172592095 TCTTGGGGTTGGAGCCCTCAGGG - Intergenic
965884704 3:173430670-173430692 TTATGAGGGATATGCCCTCATGG + Intronic
965944274 3:174220983-174221005 TTATCAGGGTAAAGCCCTAAGGG + Intronic
965955226 3:174361542-174361564 TCATGAGGAAGATGCCCTCAAGG + Intergenic
966107718 3:176357149-176357171 TCATGAGGGAGAAGCTCTCATGG - Intergenic
966216216 3:177505741-177505763 TCATGAGGGCAAAGCCATCATGG - Intergenic
966338692 3:178901158-178901180 TCATAAGGGTGGAGCCTTCATGG - Intergenic
966393335 3:179475843-179475865 TTATGAGGGCAGAGCCCTCATGG + Intergenic
966492090 3:180539385-180539407 TCATGAGGGTAAAGCCCTCATGG - Intergenic
966550386 3:181198722-181198744 TCATGTGGGTGGATCCCTCATGG - Intergenic
966805785 3:183806377-183806399 TCAGGAGTGTGAGGACCTCAAGG - Intronic
967239353 3:187422103-187422125 TCATGGGGGCGGATCCCTCATGG - Intergenic
967516730 3:190378432-190378454 TCATGAGTGATCAGCCCTCAGGG - Intronic
968290442 3:197535081-197535103 TCATAAAGGTGGAGTCCTCATGG - Intronic
968557425 4:1253505-1253527 TCAGGAGGGCAAAGCCCTCGTGG + Intergenic
968595564 4:1480658-1480680 TCAGGAGGATGGAGCCCTCATGG - Intergenic
969192769 4:5535683-5535705 TCATGAGGGTGGGGCCCCCATGG - Intergenic
969328485 4:6458482-6458504 TTGTGAGGGTGGAGCCCTCATGG - Intronic
969552970 4:7884018-7884040 TCACGGGGGTGGATCCCTCATGG + Intronic
969966853 4:11005370-11005392 TGATAAGGATGAAGCCCTCATGG - Intergenic
969978709 4:11132028-11132050 TCATGGAGGTGGATCCCTCAGGG - Intergenic
970274104 4:14379040-14379062 TCATGAGGGCAAAGCCCTCATGG + Intergenic
970351928 4:15209963-15209985 TCATGAGGGTGCAGTCCTCATGG - Intergenic
970626376 4:17888661-17888683 CCATGAGACTGAATCCCTCAGGG + Intronic
970661419 4:18290009-18290031 TCATGGGGGTGTATCCCTCACGG - Intergenic
970699057 4:18713062-18713084 TCATGAGGGTAGATCCCTCATGG + Intergenic
970719315 4:18967938-18967960 CCATGAGGGCTTAGCCCTCATGG - Intergenic
970719316 4:18967938-18967960 CCATGAGGGCTAAGCCCTCATGG + Intergenic
970791269 4:19860689-19860711 TCATGTGGGTGGATCCCTCATGG + Intergenic
970805296 4:20023870-20023892 TCATGAGGGTGGAGACCTCATGG - Intergenic
970820705 4:20208871-20208893 TCATGAAGGTGGAACTCTCATGG - Intergenic
971032871 4:22660051-22660073 TCATGAGGCTGGAGCCCTCATGG - Intergenic
971068917 4:23068041-23068063 TCATGAGAGAGGAGCCTTCATGG + Intergenic
971084002 4:23249015-23249037 TCATGAAGGTGGAGCCCTCATGG - Intergenic
971157199 4:24095876-24095898 TCACAAGGGAGAAGCCCTCACGG + Intergenic
971376521 4:26059987-26060009 TCATGAAGGTGGAGCCCTTGGGG + Intergenic
971459322 4:26877861-26877883 TTATGAGGGTAGAGCTCTCATGG - Intronic
971494593 4:27250556-27250578 TCATAGGGGTGGATCCCTCATGG - Intergenic
971883405 4:32410928-32410950 TCAGGTTGGTGAAGTCCTCATGG - Intergenic
971903958 4:32701180-32701202 TCATGAGGGTGCAGCCACCATGG - Intergenic
972016015 4:34247080-34247102 TCATGAGGGTGGAACCCTCATGG + Intergenic
972031689 4:34467666-34467688 TTATGAGGGCAGAGCCCTCATGG + Intergenic
972295221 4:37731261-37731283 TCATGATGGTGGAGCCCTCGTGG + Intergenic
972297114 4:37750549-37750571 TCATGAGGGGAGAGCCCTCATGG + Intergenic
972668186 4:41188444-41188466 TCACGAGGGTACAGCCCTCATGG + Intronic
972678650 4:41284802-41284824 TCATGAGGGTGGGGCCATCGTGG - Intergenic
972743699 4:41912627-41912649 TCAGGAGGGTCAATCCCTCATGG + Intergenic
972926289 4:44013260-44013282 TCATGAGGGCAGAGCCTTCATGG - Intergenic
972993146 4:44847140-44847162 CTATGAGAGTCAAGCCCTCATGG + Intergenic
973183172 4:47292898-47292920 TCATGAGGGTGGAGCACTCATGG + Intronic
973320804 4:48808528-48808550 TAATAAGGGAGCAGCCCTCAGGG - Intronic
973533810 4:51860741-51860763 TCATGGGGGCGGATCCCTCATGG - Intronic
973580298 4:52337965-52337987 TCACAAGGGAGAAACCCTCATGG - Intergenic
973884538 4:55307065-55307087 TCAGGGGGGTGGATCCCTCATGG + Intergenic
973933611 4:55818922-55818944 TCAGGATGGAGTAGCCCTCATGG + Intergenic
973976664 4:56269806-56269828 TCATGGGGGCGGATCCCTCATGG - Intronic
974079762 4:57199954-57199976 TCATGGGGGTGGATCCCTCATGG - Intergenic
974099470 4:57401100-57401122 TCATAAGGGCAGAGCCCTCACGG + Intergenic
974243235 4:59279804-59279826 TCATGGGGGTGGATCCCTCACGG - Intergenic
974297960 4:60028056-60028078 TCATGAGGATGGATTCCTCATGG - Intergenic
974349341 4:60724350-60724372 TCATGGGGGTGGATCCCTCATGG + Intergenic
974510544 4:62834699-62834721 TTATGGGGGTGGATCCCTCATGG + Intergenic
974789215 4:66664211-66664233 TCACAAGGGAGGAGCCCTCATGG + Intergenic
974865834 4:67579735-67579757 TCATGGGGATGAATCTCTCATGG - Intronic
974925544 4:68293761-68293783 TCACAAGGGAGAAGCCCTCATGG - Intergenic
975293247 4:72702050-72702072 TCATGAGGATGGAACCCTGATGG + Intergenic
975310195 4:72895622-72895644 TTAGGAGGGAGGAGCCCTCACGG + Intergenic
975740411 4:77424082-77424104 TCATGAGGCAGGAGCTCTCATGG + Intronic
975921745 4:79398837-79398859 TCATCAGGGTGGAGCCCTCATGG - Intergenic
975954551 4:79821994-79822016 CCATGAGGGTAGAGCCCTCATGG + Intergenic
976309831 4:83600328-83600350 TCATGAGGGTGGAGCACTCATGG - Intronic
976349344 4:84043097-84043119 TCTTGAGGGCAGAGCCCTCATGG + Intergenic
976453641 4:85220245-85220267 TCATGAGGGTGGATCCCTCATGG + Intergenic
976602342 4:86949758-86949780 TCATCTGGGTGAAGCCCACCAGG + Intronic
976770119 4:88642705-88642727 TCATGAGGGCAAAGCCCTCATGG - Intronic
976946874 4:90781120-90781142 TCATGAGGGTGGATCCCTCATGG - Intronic
977050932 4:92128197-92128219 TCATGATGCTGAGGCCCTCTGGG - Intergenic
977061182 4:92258590-92258612 TCATGAGGGTGGGTCTCTCATGG - Intergenic
977439771 4:97049846-97049868 TCATTAGGGCAGAGCCCTCATGG - Intergenic
977499642 4:97822796-97822818 TCATGGGGGTAGAGCCGTCATGG - Intronic
977652420 4:99485721-99485743 TCATGAAGGCAGAGCCCTCATGG - Intergenic
977775526 4:100915059-100915081 TCATGAAGGTAGAACCCTCATGG - Intergenic
977827419 4:101550249-101550271 CCATGAGGATGTAGCCCTCATGG - Intronic
978084298 4:104631660-104631682 TCCTGAGGGCAAAGCCCTCATGG - Intergenic
978368061 4:108003358-108003380 TCATGAGGGAGGAGCCCTCATGG + Intronic
978520939 4:109614392-109614414 TCATGAGGATAGAGCTCTCATGG + Intronic
978678912 4:111354295-111354317 TCATGAGGATGGAGCCCTCATGG - Intergenic
978712466 4:111800894-111800916 TCATGGGGGTGGATTCCTCATGG - Intergenic
978812618 4:112868505-112868527 TCCTGAGGGCAGAGCCCTCATGG + Intronic
979456220 4:120928468-120928490 TCATGAGGGGTCTGCCCTCATGG - Intergenic
979611426 4:122692803-122692825 TCATGAGGGTGGGACCCCCATGG - Intergenic
979718154 4:123866543-123866565 TCATGGGAGAGAATCCCTCATGG + Intergenic
979824020 4:125210703-125210725 CCATGAGAGTGGAGCCCTTATGG + Intergenic
980119400 4:128712218-128712240 CCATGAAAGTGAAGCCCTCATGG + Intergenic
980586618 4:134825484-134825506 TCATGAAGGTGGAGCCCTTGTGG + Intergenic
980655850 4:135784848-135784870 TCACGAGGGAAGAGCCCTCATGG - Intergenic
981016511 4:139979598-139979620 TCATGAGGGAGTAGCCTTCATGG - Intronic
981225367 4:142288029-142288051 TGATGAGTGTGAGGCCCTCATGG - Intronic
981244076 4:142513742-142513764 TCATGAAGGCAAAGCCCTCCTGG - Intronic
981355348 4:143783628-143783650 TCCTTCTGGTGAAGCCCTCAGGG - Intergenic
981613934 4:146626387-146626409 TCATGAGGGCTCTGCCCTCATGG + Intergenic
981867520 4:149441869-149441891 CCATGAGGGCACAGCCCTCATGG + Intergenic
982106496 4:152016059-152016081 TCAGGAGGGCAGAGCCCTCATGG - Intergenic
982161070 4:152569940-152569962 CCATGATGGTAGAGCCCTCATGG - Intergenic
982277084 4:153647174-153647196 TCTTAAGGGCGGAGCCCTCATGG + Intergenic
982294908 4:153817889-153817911 TTATGAGGGTAGAGCCTTCATGG + Intergenic
982413333 4:155104047-155104069 CCCTGAAGGTGGAGCCCTCATGG - Intergenic
982566752 4:156996154-156996176 TCATGGGGGTGGATCCCTCTTGG - Intergenic
982734634 4:158992829-158992851 TCATGAGGGAGGAGCCCTCATGG + Intronic
983025307 4:162729035-162729057 TCATGAGGATGGAATCCTCATGG - Intergenic
983109804 4:163735627-163735649 TAATAAGGGAGAAGCCCTTATGG + Intronic
983272690 4:165581744-165581766 CAATGAGGGTGAAGCTTTCATGG + Intergenic
983285752 4:165736793-165736815 TCATGAGAGTGAAGCCAATATGG - Intergenic
983444561 4:167833432-167833454 TCTTGATGCTGAAGCCCTCCTGG + Intergenic
983627943 4:169821893-169821915 TCATGAAGGTGGAGCCCTCATGG + Intergenic
983871732 4:172831762-172831784 TCATGAAGGTAGAGCTCTCAGGG + Intronic
984074213 4:175154380-175154402 CCATGAGGGTGGAGCCCTAATGG + Intergenic
984135468 4:175932254-175932276 TCATGATGGAAGAGCCCTCAGGG - Intronic
984284343 4:177709935-177709957 CCATGAAGGTGGATCCCTCATGG - Intergenic
984358060 4:178690826-178690848 TCATGAGCATGGGGCCCTCATGG - Intergenic
984405190 4:179320209-179320231 TCATGAGGATGGATCCCCCAAGG - Intergenic
984480796 4:180298757-180298779 TCACGGGGGTGAATCCTTCACGG + Intergenic
984782484 4:183538538-183538560 TCATGGGAGTGGATCCCTCATGG - Intergenic
984990159 4:185372636-185372658 TCATGAGGGAGGTGCTCTCATGG - Intronic
985007085 4:185544730-185544752 TCATGAGGGTAGATCCCTCATGG + Intergenic
985007523 4:185548966-185548988 TCATGAGGGTAGATCCCTCATGG - Intergenic
985056061 4:186036491-186036513 TCATGGGGGTGGATCCCTTATGG + Intergenic
985169227 4:187130556-187130578 TCATGAGGGTGGAGCCCTCATGG + Intergenic
985231155 4:187819719-187819741 TCATGAGGGCAGAGGCCTCATGG - Intergenic
985436289 4:189932396-189932418 TCATGGAGGTGGATCCCTCATGG - Intergenic
985714349 5:1446910-1446932 TCCTCAGGGTGGAGCCCTCCTGG + Intergenic
985804151 5:2028210-2028232 TCATGAGGGCGGATCCCTCATGG + Intergenic
985956082 5:3267313-3267335 TCATCAGGGTCAAGTCCCCATGG - Intergenic
986136001 5:4978498-4978520 TCTTGAGAGTGGATCCCTCAAGG + Intergenic
986425438 5:7626772-7626794 TCTTGGGGGTGGATCCCTCATGG - Intronic
986488244 5:8262251-8262273 TCATGAGGGTGGAGCACTGTTGG + Intergenic
986496188 5:8344266-8344288 TCTTCAGGGTGCAGCCCCCATGG + Intergenic
986662546 5:10072382-10072404 TCCTGAGGGTGGAGCTTTCATGG - Intergenic
986912227 5:12572413-12572435 CCATGACGGTGGAGCCTTCATGG + Intergenic
987070211 5:14329364-14329386 TCACAAGGGTGAAGCCCTCATGG - Intronic
987182325 5:15380755-15380777 TCTTGGGGGTGGATCCCTCATGG + Intergenic
987185401 5:15412253-15412275 TTATGAGGGTGACGCCCTCATGG - Intergenic
987629326 5:20447337-20447359 TCATGAGGGAGAAGTCCTCATGG - Intronic
988043133 5:25912902-25912924 TCCTCAGGGTTCAGCCCTCAAGG + Intergenic
988145195 5:27296812-27296834 CCATGAGGATGTATCCCTCAGGG + Intergenic
988220849 5:28345313-28345335 TCATGAAAGTGGAGCCCTCATGG - Intergenic
988257264 5:28836670-28836692 TAATGAAGGTGGAGCCCTCATGG + Intergenic
988345313 5:30030011-30030033 TTATGAAGGTGGAGCCCTCATGG + Intergenic
988362825 5:30257106-30257128 TCATGAGGGTGGAGCCTTTATGG + Intergenic
988425490 5:31058664-31058686 TCATGGGGGTGGATCCCTCATGG + Intergenic
988566214 5:32321551-32321573 TCATGATGGCAGAGCCCTCAGGG + Intergenic
988580212 5:32462171-32462193 TTATGAGGGTGGACCCCTCAGGG - Intergenic
988639461 5:33025539-33025561 TCATGAGGGTGTAGCCCTAATGG + Intergenic
988762865 5:34333126-34333148 ACATTACGGTGAAACCCTCAAGG - Intergenic
989070250 5:37502892-37502914 TCATGGGGGTGAATCCTTCATGG - Intronic
989196779 5:38724108-38724130 TCATGAGGGCAGAGCCCTCAGGG - Intergenic
989228937 5:39065334-39065356 TCATGGGAGTGGATCCCTCATGG - Intronic
989315419 5:40072300-40072322 TCATGAGGGAGGATTCCTCATGG - Intergenic
989341463 5:40380069-40380091 TCATGAGAGTGGAGTGCTCATGG + Intergenic
989788216 5:45357832-45357854 TCATAGGGGTGGATCCCTCAAGG + Intronic
989815624 5:45733881-45733903 TCATGAGGGTAATCCCCTCATGG - Intergenic
989954276 5:50338372-50338394 TCAGGAGTGTGCAGCCCTCCAGG - Intergenic
989974301 5:50564727-50564749 TCATGAGGGTTTCACCCTCATGG + Intergenic
990316373 5:54586650-54586672 TCATGAGCGCGGAGCCCTTATGG + Intergenic
990439692 5:55832272-55832294 TCATGGGGGTGGATCCATCATGG + Intergenic
990520194 5:56572442-56572464 TCATGAGTGTGAATTCCTCATGG - Intronic
990520478 5:56574483-56574505 TCATGGGGGTGAATTCCTCATGG - Intronic
990641291 5:57786737-57786759 CCATGAGGTTGGAGCACTCATGG + Intergenic
991036667 5:62134470-62134492 TCAGGAGGGTAAAACCCTCATGG - Intergenic
991600516 5:68347624-68347646 TCATGAGGGATCTGCCCTCATGG - Intergenic
991692120 5:69235197-69235219 TCCTGGGGGTGAATCCCTGAGGG + Intronic
992334238 5:75748970-75748992 TCATCAGGGTGGATCCCTCATGG + Intergenic
992352878 5:75949012-75949034 TCATGGGGGTGGATCCCTCATGG + Intergenic
992357370 5:75999930-75999952 TCATAAGGATGGATCCCTCATGG + Intergenic
992509808 5:77421764-77421786 AGATGACGGTGAAGCCCACAAGG - Intronic
992598420 5:78369828-78369850 TGCTGAGGGAGCAGCCCTCATGG + Intronic
992646960 5:78819998-78820020 CCATGAGGGTGGAGCCCCCAGGG - Intronic
992757652 5:79923769-79923791 TCAAAAGGGTGGAGCTCTCATGG + Intergenic
992822270 5:80509327-80509349 CCATGAAGGTGGACCCCTCATGG - Intronic
993388742 5:87291607-87291629 TCATGGGGGAGGATCCCTCATGG + Intronic
993505282 5:88701460-88701482 TCATGGGAGTGGATCCCTCATGG + Intergenic
993572799 5:89563226-89563248 TCATGAGAGTGAAGTCCGCATGG - Intergenic
993591142 5:89796517-89796539 TCATGAAAGTAAAGCCCTCATGG - Intergenic
993601019 5:89924970-89924992 TCATGAGGGTAAAGCCTTCATGG + Intergenic
993872917 5:93273023-93273045 CTATGAGGGTAAAGCCCTCATGG + Intergenic
993946735 5:94124222-94124244 TCATGGGGGTGGATCCCTCATGG - Intergenic
994275701 5:97834380-97834402 ACATGAGGGTGGAGCCCTCCTGG - Intergenic
994520959 5:100834653-100834675 TCATGTGGGTGGATCCCTTATGG + Intronic
994562206 5:101389301-101389323 CCACGAGGGTGAGGCCCTCCTGG - Intergenic
994640097 5:102396915-102396937 TCATGAGGGTGAAGCATTCATGG - Intronic
994783859 5:104129811-104129833 TCATGAAGGTGCAGCCCTCATGG + Intergenic
994834593 5:104833046-104833068 TAATGAGGGTAGAGCCCTCATGG + Intergenic
995181598 5:109235258-109235280 TCATGGGGGCGGATCCCTCATGG + Intergenic
995460789 5:112400630-112400652 TCATGGGGTTGGATCCCTCATGG - Intronic
995556595 5:113336164-113336186 CCATGAGGGTGGAGCCATCATGG + Intronic
995631344 5:114136205-114136227 TCATGATGGCAGAGCCCTCATGG - Intergenic
995634568 5:114171756-114171778 TCATTAGTGAGTAGCCCTCAGGG - Intergenic
995701424 5:114939522-114939544 TCTTCAGGGTATAGCCCTCATGG - Intergenic
995761191 5:115564103-115564125 TCATGGGGGCAAATCCCTCATGG + Intergenic
995779591 5:115761513-115761535 TCATGAGGGCAGAGCCCTCATGG + Intergenic
995921695 5:117322127-117322149 ACATGAGGGCAAAGCCCTCATGG + Intergenic
996013242 5:118503855-118503877 TCATGGGGGTGGATCCCTCATGG + Intergenic
996192802 5:120566095-120566117 TCATGAGAAAGGAGCCCTCAAGG - Intronic
996360574 5:122640997-122641019 TCATGAGGGCAGGGCCCTCATGG - Intergenic
996485373 5:124027410-124027432 TCATGAAAATGCAGCCCTCATGG + Intergenic
996572401 5:124946137-124946159 CCATGAGAATGGAGCCCTCATGG - Intergenic
996586241 5:125090771-125090793 TAATGAGGGAGCAGCCCTCATGG + Intergenic
996692451 5:126355071-126355093 TAACAAGGGAGAAGCCCTCATGG + Intergenic
996787078 5:127249988-127250010 TTATGAGGGAGGAGCCCTCATGG + Intergenic
996869962 5:128179721-128179743 TCATGGGGGTCAGTCCCTCAAGG - Intronic
996980325 5:129484321-129484343 ACATCATGTTGAAGCCCTCAGGG + Intronic
997328547 5:133042502-133042524 ACATGAGAGAGAAGCCCTAATGG + Intergenic
997451063 5:133983785-133983807 CCATGGGGGTGGATCCCTCATGG + Intronic
997815567 5:137014063-137014085 TCATGGAGGTGGATCCCTCATGG + Intronic
997904935 5:137807192-137807214 TCATGAGGGCAGAGCCCTCATGG + Intergenic
998327165 5:141291512-141291534 TCATGGGGGTGGATCCTTCATGG - Intergenic
998520931 5:142799812-142799834 TCATGAGGGCGGAGCCCCCATGG + Intronic
999136593 5:149324375-149324397 TCACGAGGGTGGAGCCCTCATGG - Intronic
999136795 5:149325877-149325899 CCATGAAGGCAAAGCCCTCATGG + Intronic
999537658 5:152535233-152535255 TCCTGAGGGCAAAACCCTCATGG - Intergenic
999700954 5:154227935-154227957 TCATGGAGGTGGATCCCTCATGG + Intronic
999704834 5:154262716-154262738 TCTTGAGGGTGCAGCCTCCAGGG - Intronic
999817981 5:155197044-155197066 TCATGGGGGCGAATCCCTCAAGG + Intergenic
999900475 5:156081286-156081308 TCATGAGGGCAGATCCCTCATGG - Intronic
1000013592 5:157257366-157257388 TCATAAGGGCAGAGCCCTCACGG - Intergenic
1000049209 5:157547402-157547424 TCATTATGGTGGAGCCCTCATGG - Intronic
1000153454 5:158527022-158527044 TCATGAGGGCAAAGCTCTCATGG - Intergenic
1000421384 5:161041931-161041953 ACATGAGAGTGAAGCCATCTTGG + Intergenic
1000442121 5:161276507-161276529 TCATGAAGGTGGGGCCTTCATGG - Intergenic
1000783505 5:165513895-165513917 CCATGAGAGTGGAGCCGTCATGG + Intergenic
1000826038 5:166044917-166044939 TCATGAGGGTGGAACTCTCATGG + Intergenic
1000881664 5:166704961-166704983 TTATGAGGGAGGAGCCCTAATGG - Intergenic
1000979573 5:167802136-167802158 TCATGAGGGCAGAGCCTTCATGG + Intronic
1001078569 5:168649572-168649594 TCATGGGGGTGGATCCCTCATGG - Intergenic
1001351662 5:170973897-170973919 TCATGAGGGCAGAGCTCTCATGG - Intronic
1001487767 5:172131885-172131907 TCATGAGGGTGGAGCCCTCATGG - Intronic
1001511456 5:172325709-172325731 TCATGAGGGAGGGGCCCTCCTGG + Intronic
1001578826 5:172784397-172784419 TCATGGGGGTGGATCTCTCATGG + Intergenic
1001716849 5:173823541-173823563 TCATGAGAGTGGATCCCTCATGG - Intergenic
1001836819 5:174839626-174839648 TCATGAGGGTGGAGCCCCCATGG - Intergenic
1001882463 5:175256381-175256403 TCATGAGGGCTCTGCCCTCATGG - Intergenic
1002357624 5:178643520-178643542 TCATGAGAGCACAGCCCTCATGG - Intergenic
1002864206 6:1107080-1107102 TCATAGGGGTGGAGCCCTCATGG - Intergenic
1003247833 6:4399323-4399345 TCATGAGGATGGAACACTCAAGG + Intergenic
1003375409 6:5572386-5572408 TCATGGGGGTGGATCCTTCATGG - Intronic
1003977943 6:11361542-11361564 TCATGGTGGTGCATCCCTCATGG - Intronic
1004161098 6:13213636-13213658 TCATGAGGGAGGAGCCCTCATGG - Intronic
1004293102 6:14386319-14386341 TCACCAGGGAGGAGCCCTCATGG + Intergenic
1004383825 6:15155115-15155137 TCATGAGGGTGGAGGCTTCATGG - Intergenic
1004400973 6:15288395-15288417 TCATAGGGGTGGATCCCTCATGG - Intronic
1004456047 6:15792300-15792322 TCATAAGCCTGAAGCCCTCATGG - Intergenic
1004777146 6:18860435-18860457 TCATGGGGGTGGATCCCCCATGG - Intergenic
1005019869 6:21407271-21407293 TCATGGGGGTGGATCCCTCGTGG + Intergenic
1005022452 6:21431296-21431318 TCATGGGGGTGGATCCCTCATGG + Intergenic
1005228385 6:23670847-23670869 TCATGAGGGTGGATCCCTCATGG - Intergenic
1005741282 6:28793282-28793304 TCATGAGGAAGGAACCCTCATGG - Intergenic
1006902169 6:37510278-37510300 ACATGAGGGTGGAGCCCTCATGG + Intergenic
1007160010 6:39782670-39782692 TCATGAGGGAGGATCCCTCATGG + Intergenic
1007281699 6:40717403-40717425 TCATGAGGGTGGATCTCTCATGG - Intergenic
1007696191 6:43735661-43735683 TCATGAGGGTGGGGTCCCCATGG + Intergenic
1007880541 6:45160959-45160981 TCATGGGGGCGGATCCCTCATGG + Intronic
1007888304 6:45257758-45257780 CCATGAGTGTGAAGCCCTGATGG + Intronic
1008135319 6:47769569-47769591 TCATGAAAGTGGAGCTCTCAAGG - Intergenic
1008275496 6:49539501-49539523 TCATGAAGGCAGAGCCCTCATGG - Intergenic
1008355901 6:50552706-50552728 TCATGGGGGACGAGCCCTCATGG + Intergenic
1008654459 6:53597446-53597468 TCATGGGGGTGGATCCCTCATGG - Intronic
1008746350 6:54674291-54674313 CCATGAGGGTGGAGGCCTCATGG - Intergenic
1008933259 6:56962031-56962053 TCATGAGGGCAGAGCCCTCATGG - Intronic
1009394814 6:63187421-63187443 TTATGAGGGAGGAGCCCTCATGG + Intergenic
1009625374 6:66133932-66133954 TCATGAGGGTGGATCCCTCAGGG - Intergenic
1009686393 6:66963154-66963176 CCATGAGGATGGAGCACTCATGG - Intergenic
1009720118 6:67457907-67457929 TCATGGGAGTGGATCCCTCATGG + Intergenic
1009801342 6:68540527-68540549 TCGTGAGGGAGGAGCCCTGATGG + Intergenic
1010116477 6:72317186-72317208 ACTTGATGCTGAAGCCCTCACGG + Intronic
1010426601 6:75734851-75734873 TCATGGGGGTGGATCCCTCGTGG - Intergenic
1010525532 6:76895701-76895723 TCATGGGGGTGGATCCCTCATGG + Intergenic
1010525819 6:76899141-76899163 TCATGAAGGTGAAGCTCTCATGG - Intergenic
1010905005 6:81476683-81476705 TCATGAAGGCAAAGCCCTCATGG - Intergenic
1011060007 6:83254397-83254419 TCATGAAGGTTGAGTCCTCATGG + Intronic
1011375752 6:86684921-86684943 CCATGAGGGTGGAGCCCTTATGG - Intergenic
1011403253 6:86987872-86987894 TCATGAAGGAGGAGCCTTCACGG + Intronic
1012035661 6:94135426-94135448 TCATGAGGCTGAAGCCCTGATGG - Intergenic
1012104395 6:95136512-95136534 TCATGAGGGCAGATCCCTCATGG - Intergenic
1012128641 6:95462797-95462819 TCATGAGGGCAGGGCCCTCATGG - Intergenic
1012201429 6:96411234-96411256 TCATGGGGGTGAATCTCTCATGG - Intergenic
1012290688 6:97452101-97452123 TCATGAGAATGGAGCCCTCATGG + Intergenic
1012411369 6:98961821-98961843 CCATAAGGGTGGAGTCCTCATGG - Intergenic
1012414367 6:98996817-98996839 CCATGAGGGTGGAGCCTTCATGG + Intergenic
1012414594 6:98999495-98999517 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1012492413 6:99796971-99796993 TCATGTGAGTGAAGACCTCATGG - Intergenic
1012609386 6:101197452-101197474 CAATGAGGGTGGATCCCTCATGG + Intergenic
1012766983 6:103379781-103379803 TCATGCGGATGGATCCCTCACGG - Intergenic
1012786736 6:103638844-103638866 TCATGTGAGTGAAGTCCTCTTGG - Intergenic
1012886574 6:104853087-104853109 TCATGAAAGAGGAGCCCTCATGG - Intronic
1013224333 6:108109240-108109262 TCATGAGGACAGAGCCCTCACGG - Intronic
1013321457 6:108994573-108994595 CTTTGAGGTTGAAGCCCTCATGG - Exonic
1013768606 6:113601561-113601583 TTATGAGGGCAAAGCTCTCATGG - Intergenic
1013820331 6:114146687-114146709 TCATGGGGGTGGATCCCTCATGG + Intronic
1013919084 6:115379034-115379056 TCATGAGAGTGGAGCCCTCGTGG + Intergenic
1014159847 6:118155379-118155401 TCAGGACGGTGAAGCCCTCACGG - Intronic
1014322745 6:119951713-119951735 TCATGAGGGTGGGGCCCCCATGG - Intergenic
1014559460 6:122872788-122872810 TCATGAGGGTGGAACCCTCATGG - Intergenic
1014572614 6:123028962-123028984 TCATAAAGGTGGAGCCCTCATGG + Intronic
1014771446 6:125462227-125462249 CCATGAAGGTGGAGCCCTCATGG + Intergenic
1015048310 6:128806430-128806452 CCATGAGGGTGGAGCCCTTGTGG + Intergenic
1015207795 6:130660144-130660166 TCATGGGGGTGGATCCCTCATGG + Intergenic
1015324952 6:131914381-131914403 TCTTGAAGGTGGAGCCCTCCTGG + Intergenic
1015606377 6:134959203-134959225 GCAGGAGGATGGAGCCCTCATGG - Intergenic
1015819876 6:137249457-137249479 TCATGAGGGTGGAGTGCTCATGG - Intergenic
1016212025 6:141548857-141548879 TCATGAGGGTTCTGTCCTCATGG - Intergenic
1016217014 6:141616874-141616896 TCATGAGGGCAGGGCCCTCAAGG + Intergenic
1016594476 6:145783962-145783984 TTATGAGGAAGCAGCCCTCATGG + Intergenic
1016601369 6:145865265-145865287 TTATGAAGGTGGAGCCCTCATGG + Intronic
1016877070 6:148876278-148876300 TCATGGGGGTGGATCCCTCCTGG - Intronic
1017189837 6:151641250-151641272 TCATGGGGGTGGATCCCTCATGG + Intergenic
1017203616 6:151781392-151781414 CCATGAAGGTGGAGGCCTCATGG + Intronic
1017617132 6:156257599-156257621 TCATTAGGGTGAAGCCCTCATGG + Intergenic
1017629535 6:156382974-156382996 TCATGGAGGTGGATCCCTCATGG + Intergenic
1017767691 6:157620314-157620336 CCATCAGGGTGAGGCCTTCATGG - Intronic
1017854187 6:158334783-158334805 TCATGAGGGTGAAACCCTCAAGG + Intronic
1018169267 6:161131565-161131587 CCATGAGGGTGAGGCCCTGCTGG + Exonic
1018234889 6:161714344-161714366 TCATGGGGGAGGAGCCCTCGTGG - Intronic
1018236062 6:161724889-161724911 TCATAGGGGTGAAACCCTCATGG + Intronic
1018510409 6:164518757-164518779 TCATGAGGGCAGATCCCTCATGG + Intergenic
1018645171 6:165941541-165941563 TCATGGAGGTGGATCCCTCACGG + Intronic
1019089570 6:169517084-169517106 TCATGGGGGTGGATCCTTCATGG + Intronic
1019956721 7:4420821-4420843 TCATGGGGGCGGATCCCTCATGG + Intergenic
1020420167 7:7994584-7994606 TCATGAAGGCAGAGCCCTCATGG + Intronic
1020542268 7:9473042-9473064 CCATGAGGGCAAAACCCTCAAGG - Intergenic
1020565760 7:9793622-9793644 TCATGAGAGCAGAGCCCTCATGG + Intergenic
1020809142 7:12830076-12830098 TCATGGGAATGAATCCCTCAAGG - Intergenic
1021018973 7:15572759-15572781 TCATGAGGGTGGAGGCCACATGG - Intergenic
1021162878 7:17298496-17298518 GGATGAGGGTGGGGCCCTCAAGG + Intergenic
1021529224 7:21624035-21624057 TAATGAGGGCAGAGCCCTCATGG + Intronic
1021778709 7:24079924-24079946 TTATGGGGGTGGATCCCTCATGG + Intergenic
1021908669 7:25362364-25362386 TAATGAGGGGGAAGTCTTCATGG + Intergenic
1022074354 7:26952918-26952940 TCATGAGGGTAGAGCACTCCTGG + Intronic
1022220247 7:28307291-28307313 TCATGAGGCTAGAGCCTTCATGG - Intronic
1022362027 7:29670082-29670104 TCATGAGGGGGGAGTCCTCATGG - Intergenic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1022386802 7:29907576-29907598 TCATGAGGGCTCTGCCCTCATGG - Intronic
1022699366 7:32743655-32743677 TCATGAGGGGGGAGTCCTCATGG + Intergenic
1022783450 7:33610591-33610613 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1022841101 7:34164572-34164594 TCATGAGGTTGGAGCCCTTATGG - Intergenic
1023086821 7:36579234-36579256 TCATGTGAGTGAAGCCATCTTGG + Intronic
1023275442 7:38514562-38514584 TCATGAAGGTGAAGCCATCATGG - Intronic
1023508654 7:40926596-40926618 TCATGAAGGTCAGTCCCTCATGG + Intergenic
1023590823 7:41778931-41778953 CCATGAGGATGAAGGCCACATGG + Intergenic
1023677597 7:42646820-42646842 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1023716718 7:43052387-43052409 TCATGAGGGTGGATCCCTGATGG + Intergenic
1024383065 7:48722090-48722112 TCATGGGGGTGGATCCTTCATGG - Intergenic
1024482013 7:49873404-49873426 TCATGAGGGTGGAGCACTCATGG - Intronic
1024489066 7:49957014-49957036 TCATGAGGGCCAAGCCCTCATGG - Intronic
1024537772 7:50452181-50452203 TCATGAGAGTGGAGACTTCATGG + Intronic
1024708175 7:51984729-51984751 TCATGGGGGCGGATCCCTCATGG - Intergenic
1026174210 7:67981748-67981770 TCCTAAGGGTGGACCCCTCATGG + Intergenic
1026292194 7:69017864-69017886 TCATGGGGGTAGATCCCTCACGG - Intergenic
1026385328 7:69841425-69841447 TCATGAGAGTGGATCCTTCATGG - Intronic
1027367003 7:77468899-77468921 TCATCATGGTGGAGCACTCATGG + Intergenic
1027388484 7:77681742-77681764 TCATGAGAGTGGAACCCTCGTGG - Intergenic
1027409594 7:77901139-77901161 CCATAAGGGTGAAGCCCTCATGG - Intronic
1027434048 7:78145535-78145557 TCATAAGGATTACGCCCTCATGG + Intronic
1027525557 7:79264974-79264996 TCATGGGGGTAAATTCCTCATGG - Intronic
1027941770 7:84691379-84691401 TCATGGAGGTGGATCCCTCATGG + Intergenic
1028970583 7:96854172-96854194 TTATGAGGACAAAGCCCTCATGG - Intergenic
1029044268 7:97611524-97611546 TAATGAGGAAGGAGCCCTCATGG + Intergenic
1029054013 7:97721162-97721184 TCATGAGGCTAGAGCCTTCATGG - Intergenic
1029357350 7:100062036-100062058 TGATGAGCGTGAAGCCCTCTTGG + Intronic
1029380788 7:100213192-100213214 TCATAGGGGTGCAGCCCTCATGG - Intronic
1029804441 7:102981760-102981782 TCATGAGGGCTTTGCCCTCATGG + Intronic
1029830929 7:103258400-103258422 TCATGAGGGGGGAGTCTTCATGG - Intergenic
1029964315 7:104722829-104722851 TCATGTTGCTGAAGCACTCAAGG - Intronic
1030186256 7:106765093-106765115 TCATGAGGATGGAACCCTCATGG - Intergenic
1030188671 7:106789532-106789554 TCATCAGGGTGGATCCCTCATGG + Intergenic
1030206952 7:106960301-106960323 TCATGAGGATGGAGCCCTCATGG - Intergenic
1030344531 7:108417447-108417469 CTATAAGGGTGGAGCCCTCATGG + Intronic
1030392673 7:108946461-108946483 TCATGAGGGCATAGCCTTCATGG + Intergenic
1030544494 7:110874996-110875018 CCATGAGGGTGGAATCCTCATGG + Intronic
1030648809 7:112094770-112094792 TCATGGGGATGGATCCCTCATGG + Intronic
1030799920 7:113837279-113837301 TCATGGGGGTGGGTCCCTCATGG + Intergenic
1030828036 7:114186043-114186065 CCATGAGGGTGTAACCCTCATGG + Intronic
1030828035 7:114186043-114186065 CCATGAGGGTTACACCCTCATGG - Intronic
1030834371 7:114264936-114264958 TCATGTGGGAGGATCCCTCATGG - Intronic
1030889600 7:114982963-114982985 TAATTAGGGAGAAGCCCTCATGG + Intronic
1030970903 7:116053549-116053571 TCATGAGGGCAGAGCCCTCTTGG + Intronic
1031147271 7:118010672-118010694 TCATGGGGGTGGACACCTCATGG - Intergenic
1031274542 7:119702643-119702665 TAATGAGGGTGGAGTCCTTATGG - Intergenic
1031280241 7:119790683-119790705 TCATGAAGGTGGATCCCTCATGG + Intergenic
1031717497 7:125126484-125126506 TCATGGGGGTGGATCCTTCATGG - Intergenic
1031790004 7:126090747-126090769 TCGTGAAGGTGGACCCCTCATGG - Intergenic
1031872370 7:127101441-127101463 TCATGGGGGCAAAGCCCTCATGG + Intronic
1031889209 7:127274559-127274581 TCATGAGGGTGCAGCCCTAAGGG - Intergenic
1032687932 7:134254580-134254602 TTATGAGGGTGAGGCCCTCATGG - Intronic
1032852343 7:135805731-135805753 TCACGAGGGCAGAGCCCTCATGG + Intergenic
1032859649 7:135864967-135864989 TCATGAGGGTGGAGGCTTCATGG + Intergenic
1033240916 7:139679291-139679313 TCACCAGGGAGAAGCCTTCACGG + Intronic
1033252503 7:139773180-139773202 TCATGTGGGTGAAGGGCGCAGGG + Intronic
1033616490 7:143021426-143021448 TTATGAGGGTTATGCTCTCAGGG + Intergenic
1033763409 7:144461526-144461548 TTATGAGGGTGGATCCCTCGTGG + Intronic
1033784959 7:144718734-144718756 TTATGGGGGTGCATCCCTCATGG + Intronic
1033818900 7:145109604-145109626 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1033832720 7:145272764-145272786 TCATGAGGGTGGGGCCCTCCTGG + Intergenic
1033876360 7:145823345-145823367 TCATAAGAGTGAAGCCTTCATGG - Intergenic
1033985386 7:147219750-147219772 TCATGAGAGCAAAGCCCTCCTGG + Intronic
1033995569 7:147342134-147342156 TTATGAGAGTGTAGCCTTCATGG - Intronic
1034071391 7:148189486-148189508 TCATGAAGGTGGAACCCTCTGGG + Intronic
1034278803 7:149837689-149837711 TCGTGAGGGTCAGGCCCTTATGG - Intergenic
1034602762 7:152278101-152278123 TCATGGGGGCAAATCCCTCATGG + Intronic
1034686820 7:152979196-152979218 TCCTGAGAGTGGAGTCCTCATGG + Intergenic
1034710255 7:153185027-153185049 TCATGGGGGTGGATCCCTCATGG - Intergenic
1034725646 7:153332876-153332898 TCATGGGGGCAAATCCCTCATGG - Intergenic
1035384225 7:158459572-158459594 TCATGTGTGTGTGGCCCTCAGGG - Intronic
1036121891 8:6027233-6027255 CCACGAAGGTGGAGCCCTCATGG + Intergenic
1036204058 8:6792621-6792643 TCACGAGGGAGCATCCCTCACGG - Intergenic
1036580439 8:10069680-10069702 TCATGAGGGCTCATCCCTCATGG - Intronic
1036589755 8:10158139-10158161 TCATGAGGATGGGGCCCTAATGG - Intronic
1037462277 8:19123257-19123279 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1037475475 8:19252737-19252759 CCATGAGGGTGAAGCCCTCATGG + Intergenic
1038009376 8:23462574-23462596 TCATGAGGGTGGAGCCCTCATGG + Intergenic
1038028055 8:23609861-23609883 TCATGAGGGATAAGCTCTCATGG - Intergenic
1038230693 8:25696982-25697004 TTATGAGGGTAGAGTCCTCATGG + Intergenic
1038380547 8:27089127-27089149 TCAAGAGGGAGGAGCCCTCTTGG + Intergenic
1038491843 8:27977173-27977195 TCATGGGGGTGGAGCCCACGTGG - Intronic
1038692525 8:29775937-29775959 TCATGGGGGTGGATCCCTCATGG - Intergenic
1038738731 8:30197708-30197730 TCATGGAGGTGGAGCCCTCATGG - Intergenic
1038810004 8:30830753-30830775 TCATGAGAGCACAGCCCTCATGG - Intergenic
1038923156 8:32108477-32108499 TCGTGAGGGAGCAGCCCTCATGG + Intronic
1039214822 8:35258256-35258278 TCATCAGGGCAGAGCCCTCATGG + Intronic
1039272989 8:35903324-35903346 TCATGGGAGTGGATCCCTCAGGG + Intergenic
1039316046 8:36373534-36373556 TCATGAGAATTGAGCCCTCATGG + Intergenic
1039671413 8:39604502-39604524 TCATGGGGGTGGATCCCTCATGG + Intronic
1039825942 8:41174209-41174231 TCATGGGGGTGGATCCCTCCTGG - Intergenic
1039883495 8:41642020-41642042 CCATGAGGATGAAGCCCTGATGG + Intergenic
1039931666 8:41996570-41996592 TCATGAGGGTGGAGCCCTCATGG - Intronic
1039943884 8:42113934-42113956 GCATGAGGGTAGAGTCCTCATGG + Intergenic
1040098573 8:43475169-43475191 TCATGGAGGTGGAGCCCTCATGG + Intergenic
1040427655 8:47304851-47304873 TCATGAGGGCAAGGCCCTCATGG - Intronic
1040719711 8:50304110-50304132 TCATGAGGGCACAACCCTCAGGG - Intronic
1040858763 8:51977426-51977448 TCCTGAGGGCAGAGCCCTCAGGG + Intergenic
1041010877 8:53542336-53542358 TCCTGAGGGTGGAGCCCTCATGG + Intergenic
1041070081 8:54119781-54119803 TCATGAGGGTGAAGATCTCATGG + Intergenic
1041316669 8:56570557-56570579 TCATGAGAGTGGAGTCCTCATGG + Intergenic
1041418287 8:57638518-57638540 CCATGAGGGAGGATCCCTCATGG + Intergenic
1042003204 8:64150060-64150082 CTATGAGGGTGGAGCCCTTATGG - Intergenic
1042105081 8:65317541-65317563 TCATGGGGGTGGATCCCTCATGG - Intergenic
1042121762 8:65496105-65496127 ATATGAGGGTGGAGTCCTCATGG + Intergenic
1042200878 8:66278626-66278648 TCATAAGGGCCAAGCCCCCATGG + Intergenic
1042203668 8:66306601-66306623 TAATGAGGATGGAGCCATCATGG + Intergenic
1042360576 8:67878109-67878131 TCATGAGGATGGAGCCGTCATGG + Intergenic
1042413637 8:68493706-68493728 TTATGAGGGTGGATCCCTCATGG - Intronic
1042501869 8:69517272-69517294 TCATGAGAGTTCTGCCCTCATGG - Intronic
1042586989 8:70351110-70351132 TCATGAGAGCAGAGCCCTCACGG + Intronic
1042628705 8:70791489-70791511 TCATAAGGGCAAAGCCCTCGTGG - Intergenic
1043037118 8:75212038-75212060 TCATGAGGTTGGAGCCCTCATGG + Intergenic
1043112825 8:76209384-76209406 CCATGAGGCTGGAGCCCTCATGG + Intergenic
1043178846 8:77058001-77058023 TCGTGGGGGTGGATCCCTCATGG - Intergenic
1043320207 8:78975263-78975285 CCATGAGGATGCAGCCCTCGTGG + Intergenic
1043384105 8:79731452-79731474 TCATGGGGGTGGATCCCTCATGG - Intergenic
1043506163 8:80905220-80905242 TCATGAGAACAAAGCCCTCATGG - Intergenic
1043658845 8:82708951-82708973 TCAGGAGAGAGGAGCCCTCATGG + Intergenic
1043815596 8:84797242-84797264 TCATGAGGGTAAAGTCCTCATGG + Intronic
1043958202 8:86387027-86387049 TCAAGAGGGCGCAGTCCTCACGG - Intronic
1044168280 8:89016927-89016949 TCATGGGGGTAGATCCCTCATGG + Intergenic
1044544892 8:93448694-93448716 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1045135107 8:99208231-99208253 TCATGAGGATGGATCCCTCATGG - Intronic
1045486884 8:102638428-102638450 ACTGGAGGGTGAAGCCCTCTGGG - Intergenic
1045686838 8:104721316-104721338 TCATGAGGGTGGAGCTCTCATGG - Intronic
1045791195 8:105986873-105986895 TCATGAGGGTGGATCCCTCATGG + Intergenic
1045791463 8:105988885-105988907 TCATGGGGGTGGATCCCCCATGG + Intergenic
1045906517 8:107352516-107352538 TCATGAAACTGAAGCCCGCAAGG - Intronic
1046424903 8:114034165-114034187 TCATGAGGGTGGATTTCTCATGG + Intergenic
1046588736 8:116180016-116180038 TCCTGAGGATGGAGCCCTCATGG - Intergenic
1046692633 8:117303266-117303288 TCATGGGGGTAAAGACCACAAGG - Intergenic
1047028544 8:120851136-120851158 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1047295562 8:123567682-123567704 TCATAAAGGTGGAGCCCTCCTGG + Intergenic
1047540931 8:125765714-125765736 TTATGAGAGGAAAGCCCTCATGG - Intergenic
1048145128 8:131834329-131834351 TCATGAGGGTGGACCCTTCATGG - Intergenic
1048308975 8:133303642-133303664 TCATGAGCGTGAAGCCCTCCTGG + Intergenic
1048505012 8:135013239-135013261 TTGTAAGGGTGAGGCCCTCATGG + Intergenic
1048642744 8:136382685-136382707 TCATGAGGGTGGAGCTCTCATGG - Intergenic
1048733423 8:137470350-137470372 TCATGAGAGAGGATCCCTCATGG + Intergenic
1048783909 8:138030372-138030394 TCATGTGGGCGAATCCCTCATGG + Intergenic
1048809306 8:138270732-138270754 CCAGTAGGGTAAAGCCCTCATGG + Intronic
1048885723 8:138907878-138907900 TCATGAGGGCACACCCCTCATGG - Intronic
1049355871 8:142187742-142187764 CCATGAGGATGATGCCCTCGTGG - Intergenic
1049474636 8:142790979-142791001 CGATGAGGGAGAATCCCTCAGGG + Intergenic
1049523494 8:143107809-143107831 TCATGGGGGTGGACCCTTCACGG + Intergenic
1049758769 8:144322474-144322496 CCATGAGGCAGACGCCCTCAGGG + Intronic
1050025549 9:1331167-1331189 TCATGAGGGAGGAGCCCTCATGG - Intergenic
1050162401 9:2732146-2732168 TCAGGAGGGAGGAGCTCTCATGG + Intronic
1050190090 9:3015836-3015858 TCATGCGAGTGGAGCCCTCATGG + Intergenic
1050320349 9:4446223-4446245 TCATTAGGGAAAAGCCCTCATGG - Intergenic
1050389196 9:5120260-5120282 TCATGAGGGAGAAGCCCTCATGG + Intronic
1050706013 9:8398607-8398629 TCATCAGGGCAGAGCCCTCATGG + Intronic
1050769282 9:9176611-9176633 TCATGAGGGCAGAGGCCTCATGG - Intronic
1051453634 9:17227150-17227172 TCATGAGGGTGGATCCCTCATGG - Intronic
1051701273 9:19826705-19826727 CCATAAGGGTAGAGCCCTCATGG + Intergenic
1051740529 9:20247452-20247474 TTATGAGGGTGAAGCCCCCATGG + Intergenic
1051781799 9:20696879-20696901 TCATGAGGGTGCTACCCTCAAGG + Intronic
1052024420 9:23558784-23558806 TAATGAGAGTGGAGCCCTCATGG - Intergenic
1052083422 9:24234845-24234867 TCATGAGGGGCTTGCCCTCATGG + Intergenic
1052596576 9:30568130-30568152 TCATGAGGACAAAACCCTCATGG - Intergenic
1052671067 9:31557902-31557924 TCATGAAAGCCAAGCCCTCATGG - Intergenic
1052679648 9:31673054-31673076 TTATAAGGGTGGAGCCCTCATGG + Intergenic
1052945762 9:34167038-34167060 TCATGAGGGTGGATCCCTCATGG - Intergenic
1053459665 9:38258522-38258544 TCATGAGGGCAGAGCCCTCACGG + Intergenic
1053493055 9:38525903-38525925 TCATGAGGGTGGAGCCCTCATGG + Intergenic
1053604382 9:39641931-39641953 TGATGAGGGAGGAGCCCGCATGG + Intergenic
1053724404 9:40983831-40983853 TCATGGAGGTGGATCCCTCATGG - Intergenic
1053724812 9:40988584-40988606 TCATGGGGGTGGATCTCTCATGG + Intergenic
1053809735 9:41839796-41839818 GCTTGAGGGTGGGGCCCTCATGG + Intergenic
1053862200 9:42397972-42397994 TGATGAGGGAGGAGCCCGCATGG + Intergenic
1053921473 9:42997561-42997583 TCATGAGGGAGGATCTCTCATGG + Intergenic
1054249158 9:62700483-62700505 TGATGAGGGAGGAGCCCGCATGG - Intergenic
1054341158 9:63863416-63863438 TCATGGGGGTGGATCTCTCATGG - Intergenic
1054341564 9:63868168-63868190 TCATGGAGGTGGATCCCTCATGG + Intergenic
1054382776 9:64511247-64511269 TCATGAGGGAGGATCTCTCATGG + Intergenic
1054563271 9:66735016-66735038 TGATGAGGGAGGAGCCCGCATGG - Intergenic
1054620858 9:67347632-67347654 GCTTGAGGGTGGGGCCCTCATGG - Intergenic
1054812656 9:69447145-69447167 GCAGGAGGGTGGAGCCCTCATGG - Intronic
1054910017 9:70446034-70446056 TCATAGGGGTGGATCCCTCATGG + Intergenic
1055019157 9:71650321-71650343 TCATGAGGGCAGAGCCCTGATGG - Intergenic
1055126503 9:72724413-72724435 TCATGAGGATAGAGCCCTCATGG + Intronic
1055351320 9:75391705-75391727 TTCTAAGGGTGGAGCCCTCATGG + Intergenic
1055367684 9:75562710-75562732 CCATGAGGGTGGAGCCCTTATGG - Intergenic
1055376190 9:75649847-75649869 TCATGGGTGTAGAGCCCTCATGG - Intergenic
1055528970 9:77164354-77164376 TCATGAAGGTGGAGCCTTCATGG + Intergenic
1055633162 9:78245427-78245449 TCTTGAGAGTGGAGCCATCATGG - Intronic
1055669524 9:78588869-78588891 CCATGAGGGTGGAGCTCTCATGG - Intergenic
1055752851 9:79526746-79526768 TCATGAGGATGTAGCCCTCTTGG - Intergenic
1055762181 9:79620974-79620996 TCATGGGGGTGAATCCTTCATGG - Intronic
1055874206 9:80923084-80923106 TCATGAGGGAGAAAACCTCATGG + Intergenic
1056469942 9:86895492-86895514 TCACGAGGGAGGAGCCCTCATGG - Intergenic
1056847161 9:90049679-90049701 CCATGCAGGTGGAGCCCTCATGG - Intergenic
1056854799 9:90117144-90117166 TTATAAGGGAGGAGCCCTCATGG - Intergenic
1056856882 9:90139496-90139518 TAATGAGTGAGAAGCACTCAAGG + Intergenic
1056980765 9:91309214-91309236 TCATGGGAGTGGATCCCTCATGG - Intronic
1057262543 9:93593234-93593256 TCCAGGGGGTGCAGCCCTCAGGG - Intronic
1057583227 9:96306216-96306238 TCATGAGGGTGGGGCCTTCATGG + Intergenic
1057637349 9:96781874-96781896 CCATGAAGGTGACGCCCTCGTGG + Intergenic
1057673293 9:97114816-97114838 TCACGAGGGTGGAGCCCTCATGG + Intergenic
1057970635 9:99554132-99554154 TCATGAGGGTAGAGCCCTCATGG + Intergenic
1057986136 9:99715853-99715875 TCATGAGGGCAGAGCACTCATGG - Intergenic
1058045734 9:100354771-100354793 TCATGGGGGTGGATCCCTCATGG - Intergenic
1058109594 9:101017825-101017847 TCATGAAAATGGAGCCCTCATGG - Intergenic
1058129460 9:101233567-101233589 CCATGAAGGTGGAGCCTTCATGG - Intronic
1058238792 9:102529078-102529100 TTATGAGGGCAGAGCCCTCACGG + Intergenic
1058523109 9:105831605-105831627 TCATGGGGGCAAATCCCTCATGG - Intergenic
1058788796 9:108419842-108419864 TCATGAGGGAGAAGTACTTATGG - Intergenic
1059117092 9:111609590-111609612 TCATGAGGGTGAAGTCTTTAGGG - Intergenic
1059263443 9:113002805-113002827 TCATGAGTGTAGAGCCTTCATGG + Intergenic
1059881608 9:118696497-118696519 CCATGATGGCAAAGCCCTCATGG - Intergenic
1059887239 9:118759727-118759749 TCATGAGGGAGAATCCCTTATGG + Intergenic
1059894921 9:118852221-118852243 TCATGAGGCAGAAGACCTCAAGG + Intergenic
1059983039 9:119794248-119794270 TCATGAGGGCTTTGCCCTCATGG - Intergenic
1060006382 9:120003731-120003753 CCAGGAGAGTGAAGCCCTCATGG - Intergenic
1060739279 9:126087635-126087657 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1060789629 9:126477252-126477274 TCATGGAGGTGGATCCCTCATGG - Intronic
1061316413 9:129798957-129798979 TAATGAGGGTAGAGCCCTCTTGG + Intergenic
1061785262 9:133024007-133024029 TCACGAGTGTGGAGCCCTCGTGG - Intergenic
1062312413 9:135946017-135946039 ACCTGAGGCTGGAGCCCTCATGG - Intronic
1062379371 9:136279829-136279851 TCACAAGGGTGGAACCCTCATGG - Intergenic
1062414766 9:136442664-136442686 GGCTGAGGGTGAAGCCCTCCAGG + Intronic
1185672114 X:1821172-1821194 TCATGAGGGCAAAGGTCTCATGG - Intergenic
1185717801 X:2356712-2356734 TGATGAGGATGAAGACCTCGGGG + Intronic
1186037872 X:5444274-5444296 TCATGAGGGTGGAGTCCTTATGG - Intergenic
1186257338 X:7736774-7736796 TCATGAGGGAGGATCCCTCAAGG + Intergenic
1186287424 X:8060573-8060595 TCATGAGGGTAGAACCCTCCTGG + Intergenic
1186545093 X:10440905-10440927 TCATGAGGGAGGAGCCCTTGTGG + Intergenic
1186718135 X:12275149-12275171 TCATGGGGGTGAATCCCTCATGG + Intronic
1186748707 X:12598534-12598556 TCATAAGCGTGAAGCTCTCAGGG + Intronic
1186965210 X:14779453-14779475 TCATGAGGGAGGAGCCCTCATGG - Intergenic
1186974698 X:14889163-14889185 TCATGAGGGAGGAACCCTTATGG + Intronic
1187071658 X:15894297-15894319 TCATGAAGGAGGACCCCTCAGGG + Intergenic
1187440527 X:19313847-19313869 CCATGAGGGTGGAGCCCTCATGG + Intergenic
1187612414 X:20956742-20956764 TCATGAGGGAGGAGCCCTTATGG + Intergenic
1187686896 X:21824693-21824715 CCATGAGGGTGGAGCCCTTTTGG - Intergenic
1187944975 X:24417046-24417068 TCATGAGGATGGAGCTGTCATGG - Intergenic
1188128241 X:26398236-26398258 CCATGACAGTGGAGCCCTCATGG - Intergenic
1188191072 X:27172502-27172524 TCATGGGGGCGGATCCCTCATGG - Intergenic
1188247827 X:27855891-27855913 AAATAAGGGTGATGCCCTCAAGG + Intergenic
1188249914 X:27880096-27880118 CCATGATGGTGGAGCCCTCATGG + Intergenic
1188424689 X:30032691-30032713 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1188480466 X:30632028-30632050 CCATGAAGGTAGAGCCCTCATGG - Intergenic
1188519215 X:31019182-31019204 TCATGAGGGTGGAACCCTCATGG + Intergenic
1188885221 X:35541803-35541825 TCATGAAGGTTACGTCCTCATGG - Intergenic
1189011931 X:37054285-37054307 TCATGGGGGTGGATCCCTCATGG + Intergenic
1189036774 X:37502000-37502022 TCATGGGGGTGGATCCCTCATGG - Intronic
1189169989 X:38900006-38900028 TCATGAGAGTGCAGCCCTCATGG - Intergenic
1189244588 X:39553756-39553778 TTATGAGGGTGGAGTCTTCATGG - Intergenic
1189351147 X:40276760-40276782 TCATGAGGGCTCTGCCCTCATGG + Intergenic
1189368574 X:40409577-40409599 CCATGACAGTGAAGCCCTCATGG - Intergenic
1189649708 X:43176442-43176464 TCATGAGGGCAAAGCTCTCATGG + Intergenic
1189666128 X:43356846-43356868 CCATGAAGGTGGAGTCCTCATGG + Intergenic
1189666357 X:43358963-43358985 CCATGAGGGTGGAGTCCTCATGG + Intergenic
1190211773 X:48454487-48454509 TCATTAGGGAGAACCCCTCATGG - Intergenic
1190526032 X:51330936-51330958 TCATGAGGGCGGATCCCTCATGG - Intergenic
1190543437 X:51500734-51500756 TCATGAGGGCGGATCCCTCATGG + Intergenic
1191044144 X:56118035-56118057 TCATGAGGGCTCTGCCCTCACGG - Intergenic
1191130235 X:57000018-57000040 TCATGAGGGTAGAGCCCCTATGG - Intergenic
1192179361 X:68906662-68906684 TCCTAAGGGTAGAGCCCTCATGG + Intergenic
1192246534 X:69377683-69377705 CCATGAGGGTGGATCCTTCATGG + Intergenic
1192377231 X:70575411-70575433 TCATGAGGGAGGAGCCCTCTGGG - Intronic
1192416547 X:70986126-70986148 TCAGGAGGGCAAAGCCTTCATGG + Intergenic
1192481470 X:71489964-71489986 TCATGAGGGAGAGGCCTTCATGG - Intronic
1192616793 X:72633253-72633275 TCATGAGTGTGCAGCCATCATGG + Intronic
1193256522 X:79355294-79355316 TCTTCAGGGTGCAGCCCCCATGG - Intergenic
1193810284 X:86042894-86042916 TCATGGGAGTGGATCCCTCATGG - Intronic
1193879663 X:86906656-86906678 TCATGAGGATGAAGCCCTCATGG + Intergenic
1193997423 X:88383793-88383815 TCATAAAGGTGGAGCCCTCATGG - Intergenic
1194053805 X:89105116-89105138 TTACAGGGGTGAAGCCCTCATGG - Intergenic
1194056326 X:89138009-89138031 TCATGAAAGTGGAGCCCTTATGG - Intergenic
1194116123 X:89900541-89900563 CCATGAGGGTGAAATCATCATGG - Intergenic
1194162158 X:90467381-90467403 TTATGAGAGTGCAGCCTTCATGG + Intergenic
1194168992 X:90558171-90558193 TCATGAGAGTGAATCACTCTTGG + Intergenic
1194347828 X:92787487-92787509 TCATGGGGGTGGATCTCTCATGG - Intergenic
1194395534 X:93379913-93379935 TCATGAGGATGGAGCCCTTATGG - Intergenic
1194472612 X:94316136-94316158 TCACAAGGGTGGAGGCCTCATGG - Intergenic
1194922388 X:99781802-99781824 TCATGGGGTTGGATCCCTCATGG - Intergenic
1195035290 X:100966362-100966384 TCATGGGGGTGGATCCCTCATGG + Intergenic
1195295444 X:103472062-103472084 TCATAAGGGTGGATCCCTTATGG - Intergenic
1195406037 X:104514427-104514449 TCATGAGGATGGGGCCTTCATGG - Intergenic
1195531992 X:105968173-105968195 TCATGAGGACAGAGCCCTCATGG + Intergenic
1195577051 X:106463020-106463042 TCATGAAGGAGGAGCCCTCATGG + Intergenic
1195629300 X:107037421-107037443 TCATGACGGCAAAGCCCTCATGG - Intergenic
1196221447 X:113115718-113115740 TCATGAGGGCAGAGCTCTCATGG + Intergenic
1196231423 X:113227267-113227289 TCATGGGGGTGTATCCTTCATGG - Intergenic
1196263118 X:113609011-113609033 TCACCAGAGAGAAGCCCTCATGG + Intergenic
1196283403 X:113851029-113851051 TCATAAGGGCTATGCCCTCATGG + Intergenic
1196362199 X:114875185-114875207 TCATGAGGGATCTGCCCTCATGG + Intronic
1196381686 X:115098210-115098232 TTATAAGGATGGAGCCCTCAGGG + Intergenic
1196638350 X:118030624-118030646 TCATGAGGGTGGTGCCCCCATGG - Intronic
1196712771 X:118780705-118780727 TCATAGGGGTGGATCCCTCATGG - Intronic
1196781915 X:119391381-119391403 TAATGAAGGAGAAGCCCTAATGG - Intergenic
1196808385 X:119608734-119608756 TCCTGAGGGAGGAGCTCTCATGG - Intergenic
1196813213 X:119644875-119644897 TAACAAGGGAGAAGCCCTCATGG + Intronic
1196865816 X:120069792-120069814 TCATGGGGGTGGAAACCTCATGG + Intergenic
1196877280 X:120166488-120166510 TCATGGGGGTGGAAACCTCATGG - Intergenic
1196902146 X:120395520-120395542 TAACAAGGGTGCAGCCCTCATGG - Intergenic
1196997830 X:121403048-121403070 TAATGAGAGCGGAGCCCTCATGG - Intergenic
1197115287 X:122824898-122824920 TCATGAGGGCTCTGCCCTCATGG + Intergenic
1197241024 X:124123348-124123370 TCATGTGGGCGGATCCCTCATGG + Intronic
1197379076 X:125716040-125716062 TCATGGGGATGGATCCCTCATGG - Intergenic
1197466978 X:126816877-126816899 TCATGAGAGTGGAGACCTCATGG - Intergenic
1197586298 X:128352354-128352376 TCATGAAGGTGGAGCCCTCCTGG - Intergenic
1197586537 X:128354450-128354472 TCATGAGGGAGTAGCCCTCCTGG - Intergenic
1197705542 X:129632046-129632068 TCATGAGGGTGGAGCATTCATGG + Intergenic
1197718601 X:129728500-129728522 TCATGAGGGTCGAGCCCACCTGG + Intergenic
1197719304 X:129734094-129734116 TCATGGGGGTGGATCTCTCATGG + Intergenic
1198164464 X:134040931-134040953 TCATGAGAGTGGAGCCCTCAAGG - Intergenic
1198390133 X:136166149-136166171 TCGTGAGGCTGAAGCACTCATGG - Intronic
1198525696 X:137498282-137498304 TCATGAGGGCAGAACCCTCATGG + Intergenic
1198546428 X:137697379-137697401 TCGTGAGGGCAGAGCCCTCATGG + Intergenic
1198742732 X:139857981-139858003 TCATGAGGGCAGAGCCCTTATGG - Intronic
1198771451 X:140135106-140135128 TCATGAGGCCAGAGCCCTCATGG + Intergenic
1198920229 X:141717224-141717246 TCGTGAGAGAGGAGCCCTCAAGG + Intergenic
1199290049 X:146095059-146095081 TCATGGGGGTGGATTCCTCATGG - Intergenic
1199461184 X:148087274-148087296 TCATGAGAATGGAGTCCTCATGG + Intergenic
1199486755 X:148356885-148356907 TCATGAGAGTGGAGCCCACATGG + Intergenic
1199549189 X:149040033-149040055 TAAAGAGGGTGGAGTCCTCATGG + Intergenic
1199577638 X:149328677-149328699 TCATGGGGGTGGATCACTCATGG + Intergenic
1199611187 X:149616059-149616081 TTATGAGGGTGGAACCCTCATGG - Intronic
1199797473 X:151214267-151214289 TTATGAAGGAGGAGCCCTCATGG + Intergenic
1199834285 X:151573195-151573217 TCATGGGGGTGGATCCTTCATGG - Intronic
1199993407 X:153003220-153003242 TCATGGGGGTGGATCTCTCATGG - Intergenic
1200123184 X:153800810-153800832 TCATGGGGGTGAGGCCCTGAGGG + Intergenic
1200300232 X:154966982-154967004 TCATGGGGGTGAATCCCTCATGG - Intronic
1200331907 X:155306826-155306848 TCATGAGGGCAAACCTCTCATGG - Intronic
1200366973 X:155676817-155676839 TTTTGAGGGAGGAGCCCTCATGG + Intergenic
1200382967 X:155859031-155859053 TCATGAGGGCAAAGCCCTCATGG - Intergenic
1200468921 Y:3557666-3557688 CCATGAGGGTGAAATCATCATGG - Intergenic
1200508435 Y:4045118-4045140 TTATGAGAGTGTAGCCTTCATGG + Intergenic
1200515234 Y:4135956-4135978 TCATGAGAGTGAATCACTCTTGG + Intergenic
1200656156 Y:5904123-5904145 TCATGGGGGTGGATCTCTCATGG - Intergenic
1201597132 Y:15682887-15682909 TCATAAGGGTGGAGCCCTCCTGG + Intergenic
1201633500 Y:16096231-16096253 TCATGAGGGTGGAGTCCTCATGG + Intergenic