ID: 1145102538

View in Genome Browser
Species Human (GRCh38)
Location 17:20088869-20088891
Sequence GGATTGTGCTTGTGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145102530_1145102538 18 Left 1145102530 17:20088828-20088850 CCTTTGGGAAGTCGGCCATGAGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1145102533_1145102538 3 Left 1145102533 17:20088843-20088865 CCATGAGGGCTTCACCCTCATGA 0: 2
1: 34
2: 159
3: 444
4: 985
Right 1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145102538 Original CRISPR GGATTGTGCTTGTGCAAAAC AGG Intronic
903192629 1:21665498-21665520 CCATTGTGCTGGTGCAAAGCAGG + Intronic
903443671 1:23407075-23407097 AGACTGTGCTTATGCAAATCAGG - Intronic
907743148 1:57186327-57186349 GGATGGTGCTTGTGTCAAAGTGG - Intronic
909900769 1:81131870-81131892 GAATTGTGCTTTTCTAAAACTGG + Intergenic
911550484 1:99273269-99273291 GGTTTCTGCCTGTGTAAAACTGG + Intronic
913519067 1:119628670-119628692 GCATTATGTTAGTGCAAAACTGG + Intronic
915802055 1:158804188-158804210 GGATTGTGCTGCAACAAAACAGG + Intergenic
915866156 1:159501188-159501210 GGAGAGTGCTTGAGTAAAACAGG - Intergenic
916680963 1:167104769-167104791 TGATTGGGCTTTTGCAAAAAAGG - Intronic
917623012 1:176817317-176817339 GGATGGAGCATGTGGAAAACTGG + Intronic
920188916 1:204179842-204179864 GGTTTGTGCTGCTGCGAAACAGG + Intergenic
923479857 1:234373755-234373777 GGGTTCCTCTTGTGCAAAACGGG + Exonic
924136439 1:240972188-240972210 GGATTCTGCTTTTGCATAAATGG - Intronic
1064849624 10:19696097-19696119 GTACTGAGCATGTGCAAAACAGG + Intronic
1065218327 10:23472027-23472049 GGTTTGTGCATATGCAAAAAAGG - Intergenic
1071265064 10:83957700-83957722 GGCTTGTGTTTGTGCAAGAGAGG + Intergenic
1071685592 10:87751955-87751977 TGAGTGTGCTTGTGTAAAAATGG - Exonic
1072094576 10:92164811-92164833 GGATTGTGCTGCTGAAAAACAGG - Intronic
1074682260 10:115919166-115919188 AGATTGTGATTATGCAAAAGAGG + Intronic
1074682262 10:115919203-115919225 TGATTGTGATTATGCAAAAGAGG + Intronic
1075056386 10:119221973-119221995 GGATTTTGCATGTGTAAATCAGG + Intronic
1080853766 11:36093891-36093913 GGTTTGTGACTGTGCAAAAAAGG + Intronic
1082663803 11:55949197-55949219 GGTTTGTGAGTGTGCAAAAGAGG - Intergenic
1084875040 11:72124815-72124837 GGTTTGTGAGTATGCAAAACAGG + Intronic
1088866786 11:113855297-113855319 GTATTGTCTTTGTGTAAAACAGG - Intronic
1092116250 12:6010405-6010427 GAGATGTGGTTGTGCAAAACTGG - Intronic
1095199957 12:39372198-39372220 GGATTGAGTTTCTGCAAACCTGG + Intronic
1095965031 12:47861392-47861414 GGATTGGGCCTGTGTGAAACTGG - Intronic
1100207619 12:92368193-92368215 GGATTGTGCTTCTGCTAATGTGG - Intergenic
1104144167 12:126017065-126017087 GGTTTGTGAGTGTGCAAAAAAGG - Intergenic
1107167744 13:37302318-37302340 GGATTGAGCTCGTTCAACACTGG + Intergenic
1107177246 13:37413375-37413397 GGATACTGCCTGGGCAAAACAGG - Intergenic
1107810086 13:44192051-44192073 GGCTTGTGCTTGTGCAGTCCAGG + Intergenic
1109510677 13:63368011-63368033 GGTTTGTGAGTGTGCAAAAGAGG + Intergenic
1110280691 13:73690464-73690486 GGATTTTGCTTGTACTAAAGAGG - Exonic
1112926115 13:104677488-104677510 GGATTTTGCAGGTACAAAACAGG + Intergenic
1113303793 13:109053834-109053856 GTATTGTGTTTGTAGAAAACGGG + Intronic
1116089265 14:40284219-40284241 GGATTATCCTTGTACAAAAATGG + Intergenic
1116170166 14:41390719-41390741 GTATTATGCTTGTGAAATACTGG + Intergenic
1118535385 14:66758052-66758074 GGTTTGTGATTATGCAAAAAAGG + Intronic
1124643710 15:31419213-31419235 GATTTGTGCTTTTGAAAAACAGG - Intronic
1128404601 15:67322882-67322904 GGTTTGTGATTATGCAAAAGAGG + Intronic
1130140569 15:81222635-81222657 GGACTTTGCTGGTGCTAAACAGG - Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135982948 16:27162779-27162801 GGACTTTGCATATGCAAAACTGG + Intergenic
1138689549 16:58754395-58754417 GGTTTGTGATTGTGCAGAAAAGG + Intergenic
1138819200 16:60238323-60238345 GGTTTGTGAGTGTGCAAAAAAGG + Intergenic
1142730425 17:1851058-1851080 GGATGGAGCTAGAGCAAAACTGG - Intronic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1145824943 17:27869841-27869863 GGTTTGTGAGTGTGCAAAAAAGG - Intronic
1153533665 18:6077278-6077300 GGATGTTGGTTGTGCATAACAGG - Intronic
1156502408 18:37567778-37567800 GTATTGTGCTTGTACCAAATGGG - Intergenic
1159799375 18:72878673-72878695 GGCTTTTGCCTGTGGAAAACTGG + Intergenic
1162466294 19:10843117-10843139 GGATTGTGAGTGTGCAAAAAAGG + Intronic
1165701263 19:37939971-37939993 GAATAGTGCCTGTACAAAACAGG - Intronic
1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG + Intronic
1168725198 19:58577260-58577282 AAACTGTGCTTGTGAAAAACAGG - Intergenic
926719261 2:15947108-15947130 GGATTGTACAGGTGCAAAAAGGG - Intergenic
929675195 2:43919699-43919721 AGTTTCTGCTTGTGAAAAACTGG + Intronic
929887382 2:45891123-45891145 GGCATGTGCTTGAGCAAAGCTGG + Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
930634703 2:53791444-53791466 GGATTCTGATTGTATAAAACAGG - Intronic
934882256 2:97994749-97994771 GTATTGTACTGCTGCAAAACGGG - Intronic
941804110 2:169693356-169693378 TAATTGTGCTTTTCCAAAACTGG + Intronic
942706397 2:178777460-178777482 GGACTGTGGTTGCCCAAAACAGG - Exonic
1172285814 20:33739658-33739680 GGAGTGTGCATGAGGAAAACTGG + Intronic
1175166872 20:57050196-57050218 GGTTTCTCCCTGTGCAAAACAGG + Intergenic
1180567668 22:16688895-16688917 GAGATGTGGTTGTGCAAAACTGG - Intergenic
1181383040 22:22522121-22522143 GGATTCTGCTTCTGGAAAAGAGG - Intergenic
951920554 3:27849749-27849771 GGAGTGTGATGGTGCAAAAGAGG + Intergenic
952789037 3:37184254-37184276 GGATTGTGCCTGTTAAAAGCTGG - Intergenic
953924762 3:46977074-46977096 GGTTAGTACTTGGGCAAAACCGG - Intronic
959660491 3:108862937-108862959 GGAAAGTGCATATGCAAAACCGG - Intergenic
959936282 3:112032597-112032619 GGATGGTGCTTGTGCTCAAGAGG - Intergenic
962339935 3:134573990-134574012 GTAGTGTGCTTGTTCAAACCTGG - Intronic
965040039 3:163495298-163495320 GGAATTTGCTTTTGCAAAACAGG + Intergenic
968206000 3:196801120-196801142 GGATTATGCTTGCACAAAAAAGG + Intronic
968299199 3:197600347-197600369 GTATTGTTCCTGTACAAAACAGG - Intergenic
969375988 4:6763507-6763529 GGGTTGTGCTTGTGGAAGAGAGG - Intergenic
974736144 4:65935624-65935646 GGATTGTGCTAGAGCAGCACAGG - Intergenic
976589024 4:86830630-86830652 GGTTTGGCCTTGTGCATAACTGG + Intronic
980820107 4:138004121-138004143 GCATTGTGCTTTGGAAAAACAGG + Intergenic
983262223 4:165469782-165469804 GGATTGTGTTTATTCATAACAGG - Intronic
983402685 4:167285324-167285346 GCATGGTGCTGGTGCCAAACAGG - Intergenic
983701437 4:170600050-170600072 GGGTTGTGCATGTGCCAAACTGG + Intergenic
985525321 5:398623-398645 GGAGTGTGTTTGTGCCAAACCGG + Intronic
987057517 5:14208939-14208961 GGATTGTGATGTTGTAAAACTGG + Intronic
989585431 5:43070946-43070968 GGTTTGTGCATATGCAAAAAAGG - Intronic
994052930 5:95382600-95382622 GGAATGTTCTTGTGCAGAAAAGG + Intergenic
994378925 5:99047419-99047441 CCATTGTGCTTGTGCCAAAATGG + Intergenic
999399228 5:151251788-151251810 AGCTTGTGCTTGTGCATAACTGG - Intronic
1002057644 5:176607841-176607863 GTTTTGTGCTTGGGCACAACTGG - Intronic
1007383697 6:41506213-41506235 GAATTGTCCATCTGCAAAACAGG - Intergenic
1015097792 6:129436906-129436928 GCATTGTCTATGTGCAAAACTGG - Intronic
1020277281 7:6632358-6632380 GAATTGTACTAGTGCAAAAAGGG + Intergenic
1020463187 7:8446615-8446637 AAATTGTGCCTGTGGAAAACAGG - Intronic
1024963384 7:55001831-55001853 GGATAGTGCTTCTGCAGATCAGG - Intergenic
1028519890 7:91718097-91718119 GGACTGTGGGTCTGCAAAACAGG - Intronic
1037736880 8:21574478-21574500 GAATTGTCTTTCTGCAAAACTGG + Intergenic
1044066533 8:87706051-87706073 GTATTGTGCATGTGGAAAAGTGG - Intergenic
1047517333 8:125566594-125566616 TGATTGTTATTGTGCTAAACAGG + Intergenic
1049392193 8:142377627-142377649 GGTTAGTGCTGGTGCATAACTGG + Intronic
1050869712 9:10551531-10551553 GAATTGTGCCTTTGTAAAACAGG + Intronic
1053291800 9:36884999-36885021 GGACTGTGCCTGCGTAAAACTGG - Intronic
1056839205 9:89984898-89984920 TCATTGTGTTTGGGCAAAACAGG - Intergenic
1056945154 9:90988488-90988510 AGATTGGGATTGGGCAAAACTGG - Intergenic
1059794251 9:117674399-117674421 AGATTTTCATTGTGCAAAACAGG - Intergenic
1061149190 9:128819249-128819271 GGTTTGTTCTTCTGCAGAACGGG + Intronic
1186043947 X:5513460-5513482 GGATTCTGCCTGTGCACTACAGG - Intergenic
1186582293 X:10833371-10833393 GGATTTTCGGTGTGCAAAACAGG + Intronic
1186704944 X:12131090-12131112 GGTATGTGCCTGAGCAAAACGGG + Intergenic
1193230508 X:79039626-79039648 GCATAGTACTTGTACAAAACAGG - Intergenic
1198429043 X:136547465-136547487 GAATTCTGCTTTTGCAAAATGGG + Intronic