ID: 1145102538

View in Genome Browser
Species Human (GRCh38)
Location 17:20088869-20088891
Sequence GGATTGTGCTTGTGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145102533_1145102538 3 Left 1145102533 17:20088843-20088865 CCATGAGGGCTTCACCCTCATGA 0: 2
1: 34
2: 159
3: 444
4: 985
Right 1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1145102530_1145102538 18 Left 1145102530 17:20088828-20088850 CCTTTGGGAAGTCGGCCATGAGG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145102538 Original CRISPR GGATTGTGCTTGTGCAAAAC AGG Intronic