ID: 1145103405

View in Genome Browser
Species Human (GRCh38)
Location 17:20095570-20095592
Sequence CCAGCCACGAGAAGAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145103405_1145103409 -7 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103409 17:20095586-20095608 TGGCTGGCTAACGGGCTGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 172
1145103405_1145103415 22 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103415 17:20095615-20095637 GCAGCCAGGGACGCTAGCACTGG 0: 1
1: 0
2: 1
3: 26
4: 149
1145103405_1145103411 -5 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103411 17:20095588-20095610 GCTGGCTAACGGGCTGTGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1145103405_1145103410 -6 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103410 17:20095587-20095609 GGCTGGCTAACGGGCTGTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 124
1145103405_1145103413 8 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103413 17:20095601-20095623 CTGTGAGGGGAGAGGCAGCCAGG 0: 1
1: 1
2: 14
3: 83
4: 668
1145103405_1145103414 9 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103414 17:20095602-20095624 TGTGAGGGGAGAGGCAGCCAGGG 0: 1
1: 0
2: 5
3: 73
4: 698
1145103405_1145103412 0 Left 1145103405 17:20095570-20095592 CCTGTGGTTCTTCTCGTGGCTGG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 1145103412 17:20095593-20095615 CTAACGGGCTGTGAGGGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145103405 Original CRISPR CCAGCCACGAGAAGAACCAC AGG (reversed) Intronic
902081676 1:13825170-13825192 CCAGCAACGGGAGGAACCAAGGG + Intergenic
902222565 1:14976364-14976386 CCGGCCACAAGAAGGACCGCAGG + Intronic
904752279 1:32748495-32748517 CCAGGCAGGAGAAGCAGCACAGG - Intronic
908250081 1:62258885-62258907 CCAGTCACAAGAAGAGCCTCAGG + Intronic
921030885 1:211334334-211334356 CCAGCCTCCAGAAGAAAAACAGG + Intronic
921676698 1:217984053-217984075 CCAGCCCAGTTAAGAACCACAGG + Intergenic
1065775170 10:29113066-29113088 CCAGGCAGGAGCAAAACCACAGG + Intergenic
1065995661 10:31056875-31056897 CCAGACACGAGAACAAACGCAGG + Intergenic
1068303842 10:55178520-55178542 CCAGACCTGAGAACAACCACTGG - Intronic
1070438255 10:76414826-76414848 CCAGCCTAGATAAGAACCAGGGG + Intronic
1070820835 10:79353188-79353210 CCAGCCAAGAGCAGAACTGCAGG - Intronic
1073524963 10:104171945-104171967 CCAGACAGGAGAAGATCCACAGG + Intronic
1075662220 10:124205864-124205886 TCAGCCACGTGAAGACCCACAGG + Intergenic
1075779837 10:125010102-125010124 CCTTTCACGAGAAGGACCACAGG + Intronic
1076394526 10:130129112-130129134 CCAGCCCAGAGCAGAACCCCTGG - Intergenic
1077514823 11:2995150-2995172 GCAGCCAAGAGCAGAACTACAGG - Intergenic
1080281469 11:30562298-30562320 CCAGACTTGAGAAGAACCAAAGG + Intronic
1081696220 11:45110849-45110871 CCACCCAGGAGCAGAACCAGTGG - Intronic
1083737159 11:64687914-64687936 CCAGGCACTAGGAGAACCAGGGG + Intronic
1084492273 11:69485420-69485442 CCAGACACCAGAAGAACCAGGGG + Intergenic
1090168681 11:124578928-124578950 CCAGCCATGGAAAGAACAACAGG + Intergenic
1090178632 11:124673899-124673921 CCAGCAACTAGAAAAACAACCGG + Exonic
1094137807 12:27147773-27147795 CCAGCCAGGCCCAGAACCACAGG + Intergenic
1094187136 12:27656847-27656869 CCAGCCAGGACCAGAACCACAGG + Intronic
1096637585 12:52970702-52970724 CCAGCCACAAGGAGCACCTCAGG + Intergenic
1099754789 12:86831325-86831347 AGAGCTACGAGATGAACCACAGG + Intronic
1103627142 12:122227793-122227815 CTGGGCACCAGAAGAACCACTGG + Intronic
1109375348 13:61485688-61485710 CCACCCAGGAGTAGAATCACAGG - Intergenic
1113594656 13:111522369-111522391 CCAGCCTCAAGAAGAGCCAGTGG - Intergenic
1114532904 14:23406509-23406531 CCAGCCAAGAGAATCACCCCTGG - Intronic
1114957464 14:27841886-27841908 CCAGCAACTAGAAGACACACGGG - Intergenic
1117337405 14:54766993-54767015 CCAGCCACGAGAGGCCCCTCTGG - Intronic
1118397260 14:65348148-65348170 CCAACCAACTGAAGAACCACTGG - Intergenic
1119968582 14:78944222-78944244 CAAGCCACCAGTAGAACCACAGG + Intronic
1121619483 14:95336439-95336461 CCAGCAGGGAGAAGAACCATAGG - Intergenic
1121803008 14:96791147-96791169 TCAGCCAAGAGAAGAAGCAGAGG + Intergenic
1122330913 14:100911840-100911862 CCACCCACGAGAATTACCACTGG - Intergenic
1125554615 15:40573801-40573823 CCGGCCTCGAGAAGGACCCCAGG - Exonic
1128498060 15:68209497-68209519 CTAGACACAAGAAGAAGCACGGG + Intronic
1129065235 15:72897562-72897584 CAAGCCATGAAAAGACCCACAGG - Intergenic
1132392792 15:101450951-101450973 CCAGCCATGAGAAGAACTCTCGG + Intronic
1133765099 16:8832454-8832476 CCAGCCCCCAGCAGGACCACGGG + Intronic
1135635421 16:24071576-24071598 CCAATCACAAGTAGAACCACTGG - Intronic
1141699828 16:85637328-85637350 CCAGCCACGAGAAGCAGGAAGGG - Intronic
1142258760 16:89032344-89032366 CCAGCCATGATAAAAATCACGGG - Intergenic
1142373933 16:89697271-89697293 CCAGCAAAGAGAAGCACCACGGG + Exonic
1142967656 17:3591305-3591327 CCAGCACCGAGAAGACCCTCAGG - Exonic
1144242539 17:13327486-13327508 CCTGGCAGGAGTAGAACCACTGG + Intergenic
1144372636 17:14606567-14606589 CCAGCCATGTGAAGACCCAGGGG - Intergenic
1145103405 17:20095570-20095592 CCAGCCACGAGAAGAACCACAGG - Intronic
1147238075 17:39072194-39072216 AGAGCCAGGAGAAGAACCACAGG + Intronic
1151171453 17:72249668-72249690 CCAGCCACAAGAAGAACCCCAGG - Intergenic
1151558567 17:74859479-74859501 CCACCCACCAGCAGAACCCCCGG + Intronic
1152724769 17:81939754-81939776 CCAGCCAGGAGCTGACCCACTGG - Exonic
1153804398 18:8699824-8699846 CCACCCCCATGAAGAACCACTGG + Intergenic
1154979703 18:21492614-21492636 GCAGCCAGGTGAAGAACCTCAGG - Intronic
1158594961 18:58807936-58807958 CCACCCAAGGGAAGAATCACAGG - Intergenic
1160505073 18:79422517-79422539 CCAGCCACGAGAAGATGCAGCGG + Intronic
1160859873 19:1233249-1233271 CCAGCCACCTGCAGAACCTCAGG + Intronic
1161085778 19:2334238-2334260 ACAGCCACGGGCAGAGCCACGGG - Intronic
1163130350 19:15268730-15268752 CCAGTCACAGGAACAACCACAGG + Intronic
1163144142 19:15369435-15369457 CCAGCTACGGAAAGACCCACAGG + Intronic
1163769081 19:19179879-19179901 CCAGCCACCAGGAGAAACCCGGG + Intronic
1166733692 19:45072183-45072205 ACCGCCACAAGAAGACCCACCGG - Exonic
1167559250 19:50215391-50215413 CCAGCCAGGAGCAGAACAACCGG - Intronic
926172094 2:10558877-10558899 CCAGCCCTGAGAAGAAGCAACGG + Intergenic
927081315 2:19633620-19633642 CCAGCCACCAGAAGGACCAAAGG + Intergenic
927243051 2:20935381-20935403 CCAGGCAGTAGAAGAGCCACAGG + Intergenic
931284272 2:60819345-60819367 CCAGCTGTGAGAAGGACCACAGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
936234648 2:110732616-110732638 CCAGCCACGCGGAGAAGCAGAGG + Exonic
938093045 2:128445745-128445767 CCAGCCAGGGGAAGAAACAGGGG + Intergenic
940973878 2:159922255-159922277 AGAGCCAGGAAAAGAACCACTGG - Intergenic
942313516 2:174678499-174678521 CTGGCCACGAGAAGAAGCAGTGG + Intronic
947968993 2:234306097-234306119 CTAACCACGAGAAGAGCCAGAGG + Intergenic
948299001 2:236888094-236888116 CCAGCACCTAGAAGAACCATGGG - Intergenic
949053983 2:241914679-241914701 CCAGCCACGAGGAAAGCCAAGGG + Intergenic
1169481978 20:5990956-5990978 CCAGGCACCAGAAGACCCAGAGG - Intronic
1170378020 20:15723593-15723615 CAAGCCACGAGAAGACACAGAGG - Intronic
1173387584 20:42603332-42603354 CCAGCCAAGTGAAGATCCAGGGG + Intronic
1175684127 20:61014789-61014811 CCACCCCCGGTAAGAACCACTGG + Intergenic
1179409309 21:41149961-41149983 CCAGCCACAAGCAGAACCCCTGG - Intergenic
1180706945 22:17816000-17816022 CCAGCCAGGAGGAGGAGCACAGG + Intronic
1180959249 22:19755264-19755286 CAAGCCGAGAGAAGAACCGCGGG - Intergenic
1181371661 22:22423893-22423915 CCAGCCAGGAGAAGAGGCTCAGG + Intergenic
1181682299 22:24503885-24503907 CCTTCCATGAGAAGAACCAGGGG + Intronic
1181734095 22:24868458-24868480 CCAGGCACGAGAGGAACTGCAGG - Exonic
1185302798 22:50091274-50091296 CCAGCCACGGGAGGAACCTGGGG - Intronic
950814681 3:15688058-15688080 CTACCCACAAAAAGAACCACAGG - Intronic
964319691 3:155482108-155482130 CCAGCCACGAGAAGTATTAGGGG + Exonic
964428893 3:156582905-156582927 CCGGCCACCAGAAGAACCTGTGG + Intergenic
965528375 3:169745804-169745826 CCAGCCACCAGAATAAAGACAGG - Intergenic
965899280 3:173618719-173618741 CCATCCACTAGAAAAGCCACTGG - Intronic
968068251 3:195770934-195770956 CCGGCCACGAGAAGACCTACAGG - Intronic
981767946 4:148273670-148273692 ACAGACACGAGAAGGAACACAGG + Intronic
982704427 4:158691938-158691960 CCAGGCACTAGAATAACCCCAGG - Intronic
985172930 4:187171723-187171745 ACACAAACGAGAAGAACCACGGG - Intergenic
985923806 5:3000139-3000161 CCAGCCCAGAGAAGAACAGCGGG - Intergenic
987071160 5:14338254-14338276 CCACATACAAGAAGAACCACTGG - Intronic
988066135 5:26230157-26230179 CCAGCCACGAGCAACACCTCTGG + Intergenic
989014487 5:36913816-36913838 CCTGCAAAGAGAAGAACCACAGG - Intronic
999316923 5:150590276-150590298 CCAGCCAGGAGATGAGCCAGGGG - Intergenic
1000259136 5:159569189-159569211 CCAGCCATGTGAAGAAGCAGGGG + Intergenic
1001143184 5:169162253-169162275 CCAGCCCCATGCAGAACCACTGG + Intronic
1002263637 5:178013986-178014008 CCTCCCACGGAAAGAACCACTGG - Intronic
1003128831 6:3377897-3377919 GCAGCCACCAAAAGAACAACAGG + Intronic
1003372464 6:5542034-5542056 CCAGCAATGAGGAGGACCACAGG + Intronic
1004355370 6:14925607-14925629 CCAGCCAAGAAAATAAGCACTGG + Intergenic
1005099504 6:22154898-22154920 CCAGCAACTAGAAGAGCCATAGG + Intergenic
1008239602 6:49093375-49093397 CCAGCCAAGAGATGTAGCACTGG - Intergenic
1012275872 6:97275014-97275036 CAAGCCTCAAGAAGAACCAGTGG + Intronic
1015917993 6:138237699-138237721 GCAGCCTAGAGAAGAACCTCTGG + Intronic
1017909052 6:158777272-158777294 CCAGCCAGGAGAACACACACTGG - Intronic
1020013725 7:4819553-4819575 CCAGCCACGAGGAGAATCTGAGG + Intronic
1020264176 7:6549357-6549379 CTAGCCACAAGAAGAACCCAAGG - Intronic
1024799612 7:53061029-53061051 CCAGCCCCGAAAAGCACAACAGG + Intergenic
1027315227 7:76981294-76981316 CCAGCTAAGAGCAGAAACACAGG - Intergenic
1032427489 7:131833302-131833324 CCAGCCACGGGAAGCACCAAGGG + Intergenic
1033260318 7:139838412-139838434 AAGGCCAAGAGAAGAACCACAGG - Intronic
1034400562 7:150858931-150858953 CCAGCCCCCAGGAGAACCCCTGG + Exonic
1036613523 8:10370788-10370810 CCAGCCAGGAGCCGACCCACAGG - Intronic
1038223948 8:25637199-25637221 CCAGCCTGGAGTAGAGCCACAGG + Intergenic
1038538712 8:28373529-28373551 GCAGCCTGGAGAAGAACCGCAGG + Intronic
1040447745 8:47512564-47512586 CCAGCCTCCAGCAAAACCACTGG - Intronic
1044139854 8:88636944-88636966 TCATCCAAGAGAAGAAACACAGG - Intergenic
1048365373 8:133733555-133733577 CCAGCCACCAGCAGGACCAAGGG - Intergenic
1049318062 8:141980223-141980245 CCCGACACTAGGAGAACCACTGG + Intergenic
1058757211 9:108094201-108094223 CTTGCCAAGAGAAGAACCAAAGG + Intergenic
1059356154 9:113701098-113701120 CCAGCCAGGAGAATGACCCCAGG + Intergenic
1062660777 9:137631445-137631467 CCTGCCAAGAGAAGAACTAGTGG - Intronic
1186884786 X:13902646-13902668 GAAACCAGGAGAAGAACCACAGG + Intronic
1192743122 X:73912661-73912683 CCAGCCCCTGGAAGAACAACTGG - Intergenic