ID: 1145110625

View in Genome Browser
Species Human (GRCh38)
Location 17:20158234-20158256
Sequence AGGGGGAAGCAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2687
Summary {0: 1, 1: 1, 2: 26, 3: 337, 4: 2322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145110622_1145110625 -10 Left 1145110622 17:20158221-20158243 CCAAAAGGATATAAGGGGGAAGC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG 0: 1
1: 1
2: 26
3: 337
4: 2322
1145110615_1145110625 14 Left 1145110615 17:20158197-20158219 CCGAGGGTCATCAGAGCAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG 0: 1
1: 1
2: 26
3: 337
4: 2322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145110625 Original CRISPR AGGGGGAAGCAGAAGGAGAA GGG Intronic
Too many off-targets to display for this crispr