ID: 1145111036

View in Genome Browser
Species Human (GRCh38)
Location 17:20161868-20161890
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145111036_1145111043 16 Left 1145111036 17:20161868-20161890 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1145111043 17:20161907-20161929 GCCTCAGCCTCTTGAGTACCTGG 0: 63
1: 4795
2: 102577
3: 208701
4: 232738
1145111036_1145111045 17 Left 1145111036 17:20161868-20161890 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1145111045 17:20161908-20161930 CCTCAGCCTCTTGAGTACCTGGG 0: 74
1: 6144
2: 117485
3: 220419
4: 240586
1145111036_1145111047 25 Left 1145111036 17:20161868-20161890 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 1145111047 17:20161916-20161938 TCTTGAGTACCTGGGACTACAGG 0: 37
1: 2645
2: 53802
3: 178185
4: 229694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145111036 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr