ID: 1145114555

View in Genome Browser
Species Human (GRCh38)
Location 17:20197185-20197207
Sequence CTGAACTCCTTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 11, 2: 22, 3: 38, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145114555 Original CRISPR CTGAACTCCTTGGGAAAAAC AGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901939880 1:12653838-12653860 CTAAACTTCCTGGGAAAAAGAGG - Intronic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
904594421 1:31634161-31634183 CTGACTTCCTTGGAAAAATCCGG + Intronic
905697257 1:39983998-39984020 ATGAACTAATTGGAAAAAACTGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
910264943 1:85328615-85328637 CTGAACTTCTTGGGTAAACTAGG - Intronic
910506443 1:87954716-87954738 CTCAACCCCTTGTGAAACACTGG - Intergenic
913563850 1:120050749-120050771 CTGAAATCCTTGCCAAAACCAGG - Intronic
913634275 1:120742814-120742836 CTGAAATCCTTGCCAAAACCAGG + Intergenic
914284444 1:146210123-146210145 CTGAAATCCTTGCCAAAACCAGG - Intronic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
914545476 1:148660864-148660886 CTGAAATCCTTGCCAAAACCAGG - Intronic
914621092 1:149409809-149409831 CTGAAATCCTTGCCAAAACCAGG + Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
915526160 1:156477462-156477484 CTGAAGTCAGTGGGAAGAACTGG + Intronic
917033118 1:170716934-170716956 CTGCATTCTTGGGGAAAAACAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921546858 1:216483598-216483620 CTAAACTTCCTGGGAAAAAGAGG + Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923579167 1:235191121-235191143 CTGACCTACTTGTGAAAAATAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1068478643 10:57561922-57561944 CTCAACTCCTTTAGAAAATCTGG - Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070949041 10:80416219-80416241 CTAAAGTTCTTGGGACAAACAGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072712633 10:97726787-97726809 CTCACCTCCTTGGGAGTAACAGG + Intergenic
1074675257 10:115841229-115841251 CTAAACACCTAGGGAAAAATAGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078691016 11:13580364-13580386 CTCAACTCCTTTGGAATATCTGG + Intergenic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1081800913 11:45858768-45858790 CTGAACCCTTTGGGAAAGAACGG + Exonic
1081883286 11:46472345-46472367 CTGAACTACTTGAGACAAGCTGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087651577 11:100874581-100874603 GTGAACTCCATGGAAAATACGGG - Intronic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1088225215 11:107612555-107612577 CTGAACCACTTGGGAAATGCTGG + Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1092609762 12:10159739-10159761 CAGAACTCCTTTGCAGAAACTGG - Exonic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1095705344 12:45230885-45230907 TTGAACTCCTGGGGAACTACAGG - Intronic
1095899530 12:47313674-47313696 CTGAAGACCTTGGGAAAGAATGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099130392 12:78821999-78822021 CTTAACTCATTGGCCAAAACTGG - Intergenic
1101185036 12:102267172-102267194 CTCAAGTCCTGAGGAAAAACAGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1104213344 12:126711624-126711646 CTGACCTCATGAGGAAAAACAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110303766 13:73959975-73959997 CTAAACTCCCTGAAAAAAACTGG + Intronic
1111717756 13:91901563-91901585 CTCAAATACTTGGGAAATACTGG - Intronic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1113153741 13:107293680-107293702 CTTACATCCTTGTGAAAAACGGG + Intronic
1115923159 14:38400820-38400842 CTTAACTCCCTGGGTAATACAGG + Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116496230 14:45563883-45563905 CAGAACTCCTTGTGACAATCTGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1118545383 14:66881362-66881384 CTTAATTCCATAGGAAAAACGGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121695643 14:95909765-95909787 CTGAGCTCCTTTGGAAGGACAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1123738188 15:23206696-23206718 CTCAAATACTTGGGAAATACTGG - Intergenic
1124289396 15:28435360-28435382 CTCAAATACTTGGGAAATACTGG - Intergenic
1124293826 15:28481948-28481970 CTCAAATACTTGGGAAATACTGG + Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1126564937 15:50085087-50085109 CTGAAGGCCTTGGTAACAACTGG - Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1130648380 15:85748128-85748150 CTAAAATCCTTGGGAAGACCTGG - Intronic
1130829086 15:87581325-87581347 CTGAATTCCTTGGTACAAATTGG + Intergenic
1132278766 15:100594050-100594072 CTCAACTCCCTGGCAAAAAATGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1144489517 17:15696604-15696626 CTGATCTCTTTGAGAAATACAGG - Intergenic
1144911451 17:18685353-18685375 CTGATCTCTTTGAGAAATACAGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145166212 17:20614884-20614906 CAGATCTCCTTGGGTAAATCTGG - Intergenic
1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG + Intronic
1151506148 17:74528730-74528752 CTGAACTAGTTGGGAAACCCTGG + Intronic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG + Intergenic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1160748807 19:724040-724062 CTGAACTCCGTGTGAACCACGGG + Intronic
1161044883 19:2129450-2129472 CTGAACCCCTGGGGAACAAGGGG + Exonic
1162590743 19:11589524-11589546 CTGAACTGCTTGGGAGTAGCAGG + Intronic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166412723 19:42567088-42567110 CTTAACTCCTGGGGTAAAAGAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929019625 2:37538691-37538713 CTGAAGTCCTTGAGAAGAAGGGG + Intergenic
930053468 2:47234719-47234741 CTGACCTCATTGAGAAAAAAAGG - Intergenic
931837643 2:66115940-66115962 CTGAAGTAAATGGGAAAAACTGG - Intergenic
932531085 2:72533299-72533321 CTGACTTGCTTGGGAAAATCAGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933112867 2:78426300-78426322 CTCAACTCTTTGGGAAGAAAAGG - Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935808283 2:106770414-106770436 CTGAAATCCTTGGGATAGAGAGG - Intergenic
937097482 2:119245219-119245241 ATGATTTCCTCGGGAAAAACTGG - Intronic
938041279 2:128078217-128078239 CTAAAATCCGTGGGCAAAACGGG - Intergenic
939539253 2:143473429-143473451 CTGAACTGCTTGACAAAAATGGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943589057 2:189775623-189775645 CCTAACTCATTGGGAACAACTGG - Exonic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
945874173 2:215260505-215260527 GTGAGCTCCTTGGGAACAAAGGG + Intergenic
946127052 2:217572160-217572182 GTGAACTCCTGGGGAATAAAAGG - Intronic
948471183 2:238180824-238180846 CTGAACTCCTTGAAAATAATTGG - Intronic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1176863135 21:14025145-14025167 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
1178364066 21:31973881-31973903 ATAAACTCCTTGGGATAAAATGG - Intronic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1180637093 22:17269920-17269942 CTGACCTGCTTAGGAAACACAGG + Intergenic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952252531 3:31668675-31668697 CTGATCTTCTTGGGATACACTGG + Exonic
955486575 3:59440063-59440085 TTGAGCCCCTTGGGAAGAACAGG + Intergenic
956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG + Intronic
958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG + Intergenic
958953685 3:100443655-100443677 CTAAAATCCCTGGGGAAAACTGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961822177 3:129580735-129580757 CTAAACTCCAGGGGAAGAACTGG + Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966541880 3:181101128-181101150 CTTAAGTCCTTGGGACAAGCAGG + Intergenic
968393236 4:210395-210417 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
968402345 4:308710-308732 CTGAAGTCTCTTGGAAAAACTGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969877078 4:10143592-10143614 CTGAACTGCTTGGGCAGAATAGG + Intergenic
971540700 4:27813264-27813286 CAGAACTCAATTGGAAAAACTGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974634278 4:64539068-64539090 CTTAGCTCCTTGTGAAAAAATGG + Intergenic
974789855 4:66672970-66672992 ATGAACTCCTTGGTAACAATGGG - Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
975221278 4:71814910-71814932 CTGAGCTTGTGGGGAAAAACAGG + Intergenic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
977278751 4:95011901-95011923 CTGAACTACTTGGGAAACTAGGG + Intronic
981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983813329 4:172091512-172091534 AAAATCTCCTTGGGAAAAACTGG - Intronic
984130683 4:175871877-175871899 ATGATCTCCTTGGGAATATCTGG - Intronic
984605880 4:181785739-181785761 CTGAAATACTTGGGAACTACAGG - Intergenic
988675373 5:33427919-33427941 CTGAACTCTTTGGTAAATTCAGG + Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
999030373 5:148284045-148284067 CAGATCTCCTTGGCAAAAATGGG + Intronic
999284666 5:150387213-150387235 CTGAACTCCATGAGACAATCAGG - Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1001069386 5:168571218-168571240 CTGACTTCCTTGGGAACAATTGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003834223 6:10050626-10050648 CAGAACACCCTGGGGAAAACAGG + Intronic
1005465171 6:26105599-26105621 CCGAACTCATTGGGAAACAATGG + Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007492315 6:42232885-42232907 CTGAACACCTGGGGAAGAAAGGG + Exonic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010562514 6:77368442-77368464 CTGAATTCAGGGGGAAAAACAGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1015311678 6:131773724-131773746 TTGAACTCCTTGGTTGAAACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015582758 6:134744567-134744589 CTGAACTCATTAAGAAAGACTGG + Intergenic
1016297016 6:142584289-142584311 TAAATCTCCTTGGGAAAAACTGG + Intergenic
1016502535 6:144737946-144737968 CTCAACTCATTGGGATAGACAGG - Intronic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021568561 7:22039836-22039858 GTGAACTCATTGGAAACAACAGG + Intergenic
1022425652 7:30266481-30266503 CAGAACCCCTTTGCAAAAACTGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1029026238 7:97419657-97419679 CTGAAGTCTTAGGGAAAAGCAGG + Intergenic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029974507 7:104820483-104820505 CTGAAGCCCTTGGCAAAATCAGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031675608 7:124608275-124608297 CCTAACACCTTGGGAAAAATAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1031899070 7:127391016-127391038 TTGAACTCATTGGGAGAATCAGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1045340361 8:101249120-101249142 CTGAAACACTTGGAAAAAACAGG - Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1049279611 8:141737588-141737610 CTGAACTCCGTGGGACCAACAGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050532494 9:6602785-6602807 CTGAACTTCTTAGGAGACACAGG + Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050879964 9:10687313-10687335 CTGAACTCTCTGAGAAAAAATGG - Intergenic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052926887 9:34024601-34024623 CTGAAATCTTCTGGAAAAACGGG + Intronic
1055528470 9:77159169-77159191 CACAACTGCTTGGGAGAAACAGG - Intergenic
1055604033 9:77949407-77949429 CTGAATCTCTTGGGAGAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058917038 9:109577563-109577585 CTTAACTCCTTGGGTTAAAGAGG + Intergenic
1059399468 9:114059774-114059796 CTGAGCTCCTTGGGCACAGCAGG + Intergenic
1061778516 9:132982338-132982360 CTCAACTCCTTGGGCAACAAAGG + Intronic
1187548274 X:20275013-20275035 CAAAACTCCTTGAGAAATACAGG - Intergenic
1188937401 X:36193552-36193574 CTGAATTCCTGGGGAAACATAGG + Intergenic
1189203892 X:39221322-39221344 CAGAGCTGCTTGTGAAAAACTGG + Intergenic
1190149717 X:47935077-47935099 CAGAACGCAATGGGAAAAACTGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192623846 X:72707501-72707523 ATGAACTCCCTGAGAAAAAGGGG + Intronic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195581424 X:106507932-106507954 CTAAAGCCCTTTGGAAAAACTGG + Intergenic
1198152396 X:133923654-133923676 CTGAACAGCATGGGAACAACTGG + Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198461654 X:136868851-136868873 CTTACCTCTTGGGGAAAAACAGG - Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic