ID: 1145114794

View in Genome Browser
Species Human (GRCh38)
Location 17:20199220-20199242
Sequence GGAGTTACAGGCATGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 607}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145114789_1145114794 -3 Left 1145114789 17:20199200-20199222 CCTCAGCCTCCCAAGTAGCTGGA 0: 5379
1: 101964
2: 212023
3: 250600
4: 262115
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607
1145114785_1145114794 29 Left 1145114785 17:20199168-20199190 CCTTCGTCTCCTGGGTTCAAGCA 0: 13
1: 805
2: 10289
3: 44029
4: 98163
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607
1145114790_1145114794 -9 Left 1145114790 17:20199206-20199228 CCTCCCAAGTAGCTGGAGTTACA 0: 71
1: 4069
2: 60574
3: 158229
4: 269032
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607
1145114786_1145114794 20 Left 1145114786 17:20199177-20199199 CCTGGGTTCAAGCAATTCTCCTG 0: 30582
1: 98870
2: 203067
3: 190538
4: 143094
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607
1145114787_1145114794 1 Left 1145114787 17:20199196-20199218 CCTGCCTCAGCCTCCCAAGTAGC 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607
1145114784_1145114794 30 Left 1145114784 17:20199167-20199189 CCCTTCGTCTCCTGGGTTCAAGC 0: 2
1: 15
2: 186
3: 873
4: 1780
Right 1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG 0: 1
1: 0
2: 2
3: 63
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145114794 Original CRISPR GGAGTTACAGGCATGTGCTG TGG Intronic
901726352 1:11245626-11245648 GGGATTACAGACATGAGCTGTGG - Intronic
902159866 1:14521115-14521137 GGTGTTACAGGCAGATGCTGAGG + Intergenic
902482928 1:16721037-16721059 GGAGTTACAGGCAGGGCCTCAGG - Intergenic
902508296 1:16952155-16952177 GGGATTACAGGCATGAGCTACGG + Intronic
902624592 1:17669210-17669232 GGAGACCCAGGCATGTGCTTTGG + Intronic
903549249 1:24146339-24146361 GGAATTACAGGCATGAGCCATGG - Intergenic
903621004 1:24698305-24698327 GGGATTACAGGCATGAGCTGTGG - Intergenic
904088253 1:27926247-27926269 GGGATTACAGGCATGAGCTATGG + Intergenic
904442495 1:30540789-30540811 GGAGCTTCTGGCTTGTGCTGAGG + Intergenic
905933204 1:41804239-41804261 GCAGGTACAGGCAGGGGCTGTGG - Intronic
907067259 1:51497706-51497728 GGAATTACAGGCATGAGCCACGG - Intronic
908345069 1:63224391-63224413 GGGATTACAGGCATGAGCTATGG - Intergenic
908670492 1:66542047-66542069 GTAGTTTCAGGCATCCGCTGGGG - Intronic
909366319 1:74827169-74827191 GAAGTTTCAGGCATCTGCTGGGG - Intergenic
909540891 1:76790348-76790370 GGAGTCACAGGCTTTTGTTGTGG - Intergenic
909573512 1:77146389-77146411 GGGATTAGAGGCATGAGCTGTGG - Intronic
909607793 1:77523951-77523973 AGAGTTTCAGGCAGGTGCGGTGG - Intronic
909653802 1:78007309-78007331 GGAATTACAGGCATGAGCCACGG - Intronic
910007757 1:82419747-82419769 AGTGTTACAGCCATGTGCTGGGG - Intergenic
911109549 1:94167860-94167882 GAAGTGACAGGCATGTGATCAGG + Intronic
911202385 1:95058479-95058501 GGGATTACAGGCATGTGCCACGG - Intronic
913064482 1:115238046-115238068 GGAGTCACAGGCCTGTGTTTTGG + Intergenic
913371625 1:118105969-118105991 GGAGTTACAGCCATGTGGTCAGG + Intronic
913612794 1:120524576-120524598 GGAGTTACAGGCAGGGCCTTAGG - Intergenic
914578397 1:148997671-148997693 GGAGTTACAGGCAGGGCCTTAGG + Intronic
915390408 1:155538311-155538333 GGGATTACAGGCATGAGCTATGG + Intronic
915929567 1:160051190-160051212 GGGATTACAGGCATGAGCTACGG + Intronic
916185018 1:162122773-162122795 GGGGTTACAGGCATGAGCCATGG + Intronic
916539860 1:165742531-165742553 GGAATTACAGGCATGAGCCACGG + Intronic
916968563 1:169981630-169981652 GTAGTTTCAGGCATCTGCTGGGG + Intronic
917214039 1:172659429-172659451 GGAGACACAGGCCTGTGCTGTGG - Exonic
917783691 1:178428723-178428745 GGGATTATAGGCATGAGCTGTGG + Intronic
917902420 1:179555848-179555870 TGTGTGACAGGCCTGTGCTGAGG + Intronic
917940955 1:179921024-179921046 GGGATTACAGGCATGAGCCGCGG + Intronic
918033468 1:180841172-180841194 TGAGTTAGAGACCTGTGCTGGGG - Intronic
918385336 1:184001689-184001711 GGTGTGACACGAATGTGCTGGGG - Intronic
918825042 1:189313514-189313536 GAAGTTATAGGAATTTGCTGAGG - Intergenic
919661837 1:200255097-200255119 GGGATTACAGGCATGAGCTATGG + Intergenic
919903706 1:202062782-202062804 AGAATTACAGCCAGGTGCTGTGG - Intergenic
920567152 1:206983386-206983408 GCAATTACAGGCACATGCTGAGG - Intergenic
921077965 1:211714963-211714985 GGGATTACAGGCATGTGCACTGG + Intergenic
921093467 1:211865175-211865197 GGGATTACAGGCATGAGCTGCGG + Intergenic
922709329 1:227815524-227815546 CGAGACACAGACATGTGCTGGGG + Intergenic
923102801 1:230830153-230830175 GGGGTTACAGGCATGAGCTACGG - Intergenic
923109098 1:230876791-230876813 GGGGTGGCTGGCATGTGCTGAGG - Intergenic
923176396 1:231470526-231470548 GGAATTACAGGCATGAGCAATGG + Intergenic
923695617 1:236247581-236247603 GGAGTTAAGGGCATGTGTTGAGG - Intronic
923995640 1:239491008-239491030 GGGATTACAGGCATGAGCTGTGG + Intronic
924207466 1:241728060-241728082 GGGATTACAGGCATGAACTGCGG - Intronic
924225804 1:241920721-241920743 GGAATTACAGGCATGAGCCACGG + Intergenic
1063882628 10:10546834-10546856 GGGATTACAGGCATGAGCTACGG - Intergenic
1064400354 10:15015880-15015902 GGAATTACAGGCATGAGCCATGG - Intergenic
1064734234 10:18364222-18364244 GGGATTACAGGCATGAGCCGCGG + Intronic
1064735892 10:18381418-18381440 GGGGTTACAGGCATGAGCCACGG - Intronic
1064747883 10:18495682-18495704 GGATTTACAGGCATGAGCCACGG + Intronic
1065205488 10:23353905-23353927 GGACTTACAGGCATGAGCCAAGG - Intergenic
1065794646 10:29294778-29294800 GCAGTTTCAGGCATCAGCTGGGG - Intronic
1066108342 10:32175230-32175252 GGGGTTACAGGCGTGAGCTACGG + Intergenic
1066678480 10:37913375-37913397 GGGATTACAGGCATGAGCTGCGG + Intergenic
1067416087 10:46104297-46104319 GGAATTACAGGCATGAGCCACGG + Intergenic
1067436227 10:46280783-46280805 GGAATTACAGGCATGAGCCACGG + Intergenic
1067856265 10:49796240-49796262 GGTATTACAGGCATGAGCTATGG - Intergenic
1068746216 10:60533463-60533485 GTAGTTACTGGCATGTGTGGAGG - Intronic
1068868208 10:61917028-61917050 GGGATTACAGGCATGTGCCATGG - Intronic
1069643086 10:69968992-69969014 TGTGTCACAGGCCTGTGCTGAGG - Intergenic
1069778961 10:70943028-70943050 CTAATGACAGGCATGTGCTGAGG + Intergenic
1070696751 10:78569550-78569572 GCAGCTCCTGGCATGTGCTGGGG + Intergenic
1070799936 10:79239398-79239420 AGAGTGACAGGCATGAGCTCAGG - Intronic
1070957826 10:80475853-80475875 GGGATTACAGGCATGAGCCGTGG + Intronic
1071491694 10:86140670-86140692 GGAGTTCGTGGCAGGTGCTGAGG - Intronic
1071761721 10:88615939-88615961 GGAGTTACAGGCCTGAGCCATGG - Intergenic
1072099470 10:92215709-92215731 GGAATTACAGGCATGAGCCATGG + Intronic
1072449762 10:95530695-95530717 GGAGTTGAAGGAATGTGTTGAGG - Intronic
1072655985 10:97330860-97330882 GGAATTACAGGCATGAGCCACGG - Intergenic
1072680666 10:97503980-97504002 GGAGGTACAGGGATGGGATGGGG - Intronic
1073479289 10:103776114-103776136 GGAATTACAGGCATGAGCCACGG - Intronic
1073651127 10:105359627-105359649 GCAGTTTCAGGCATTTACTGGGG - Intergenic
1074145004 10:110709837-110709859 GGGATTACAGGCATGAGCAGTGG + Intronic
1074163386 10:110853105-110853127 TGAGTTGCAGGGATGTCCTGGGG - Intergenic
1074180512 10:111058899-111058921 GGGGTTACAGGCATGAGCCATGG + Intergenic
1074882332 10:117668775-117668797 GAAGTTACAGGGATCTGGTGGGG - Intergenic
1075999117 10:126901686-126901708 AGAGTTACAGGCATGAGCCACGG + Intergenic
1076636243 10:131884040-131884062 GGAGTCACAGACACCTGCTGGGG + Intergenic
1076911626 10:133392968-133392990 GGAATTACAGGCATGAGCCATGG - Intronic
1077424729 11:2469539-2469561 GGGATTACAGGCATGAGCTACGG + Intronic
1078464936 11:11543365-11543387 GGAGTGACAGGGACGTGGTGAGG + Intronic
1078685428 11:13526016-13526038 GGGATTACAGGCATGTGCCACGG + Intergenic
1078927344 11:15886698-15886720 GGAGTGACAGGAATGTGATGGGG - Intergenic
1079206094 11:18415963-18415985 GGAATTACAGGTGTGAGCTGCGG + Intronic
1079848108 11:25495932-25495954 GGATTTTCTGGCATGAGCTGTGG + Intergenic
1079905183 11:26236546-26236568 GGGATTACAGGCATGAGCCGCGG - Intergenic
1080569958 11:33546754-33546776 GCAGTTTCAGGCATCTACTGGGG - Intronic
1081162503 11:39767246-39767268 TGAGATACAGTCATGTGATGTGG + Intergenic
1081898032 11:46603849-46603871 GGAGTTTCAGGAATGTGAAGTGG + Exonic
1083827196 11:65210540-65210562 GCAGATACAGGCCAGTGCTGTGG + Intronic
1086119230 11:83288008-83288030 GGGATTACAGGCATGAGCTGCGG + Intergenic
1088992073 11:114962344-114962366 GGAATTACAGGCATGAGCCATGG + Intergenic
1089038067 11:115417396-115417418 GGAGTTTCAGGCATCCACTGGGG - Intronic
1089371415 11:117962000-117962022 GGAATTACAGGCATGAGCCACGG - Intergenic
1090295252 11:125581925-125581947 GGAATTACAGGCGTGAGCCGTGG - Intronic
1090380053 11:126320155-126320177 GGGATTACAGGCATGAGCTACGG + Intronic
1090627957 11:128622285-128622307 GGAGTTCCAGGGATGTTCTTGGG + Intergenic
1090779602 11:129995673-129995695 GGAGTTACAGGCGTGCGCTACGG - Intronic
1090856867 11:130617464-130617486 GTGGTTTCAGGCATCTGCTGGGG + Intergenic
1090962063 11:131565821-131565843 TGAGTTACATGGTTGTGCTGAGG - Intronic
1091677426 12:2501368-2501390 GGAGTCCCAGGCACCTGCTGAGG - Intronic
1092244566 12:6856358-6856380 GGAGGTGCAGGCATGGGATGGGG + Exonic
1092719032 12:11422335-11422357 GGAATTACAGGCATGAGCCATGG - Intronic
1092808700 12:12251636-12251658 GGAATTACAGGCATGAGCCACGG + Intronic
1093939746 12:25040236-25040258 GGGATTACAGGCATGAGCCGGGG - Intronic
1093969589 12:25362750-25362772 GGAGGTACAGGTATATCCTGGGG + Intergenic
1094191167 12:27699912-27699934 GGGATTACAGGCATGTGCCACGG - Intergenic
1096017935 12:48295558-48295580 GGGATTACAGGCATGAGCTACGG + Intergenic
1096068090 12:48757044-48757066 GGAATTACAGGCATGAGCCACGG + Intergenic
1096375154 12:51103010-51103032 GGGATTACAGGTATGAGCTGCGG - Intronic
1096582937 12:52600124-52600146 AAAGTTACAGGTGTGTGCTGAGG - Intronic
1097147473 12:56951676-56951698 GGAGGTAATGGCATGGGCTGAGG + Exonic
1097662898 12:62449887-62449909 GGGGTTACAGGCATGAGCCATGG - Intergenic
1097993165 12:65858019-65858041 GGAGGTGCAGGCATTTCCTGAGG + Exonic
1098099345 12:66997306-66997328 AGAATTACAGACATGTGCTGTGG - Intergenic
1098379276 12:69851930-69851952 GGGATTACAGGCATGAGCTGTGG + Intronic
1098905865 12:76161912-76161934 GGAATTACAGGCATGAGCCACGG - Intergenic
1098915774 12:76255400-76255422 GTAGTTACAGGCATGCATTGAGG + Intergenic
1099598547 12:84701079-84701101 GGGGTTACAGGCATGAGCCATGG + Intergenic
1100645834 12:96530217-96530239 GGGGTTACAGGCATGAGCCATGG - Intronic
1101378554 12:104192185-104192207 GGGATTACAGGCATGAGCTAAGG - Intergenic
1102892736 12:116573192-116573214 GGCATTACAGGCATGAGCTACGG + Intergenic
1103090889 12:118097341-118097363 GGAATTACAGGCATGAGCCACGG - Intronic
1103123790 12:118403426-118403448 GGTGTTGCAGGCAAGTGCTCAGG - Exonic
1104444317 12:128821615-128821637 GGGGTTACAGGCATGAGCCACGG - Intronic
1104584289 12:130035523-130035545 GGACTTACAGCCAGGTGCTCAGG + Intergenic
1104668560 12:130665252-130665274 GGGATTACAGGCATGAGCTGGGG - Intronic
1105295339 13:19084355-19084377 GGGATTACAGGCATGAGCCGGGG - Intergenic
1105459731 13:20572487-20572509 GAAATTACAGGCATGAGCTACGG + Intronic
1106070763 13:26408658-26408680 GGGATTACAGGCATGAGCCGTGG - Intergenic
1106337243 13:28795520-28795542 GGGATTACAGGCATGAGCTAAGG + Intergenic
1106818769 13:33440047-33440069 GGAGTTCCAGGCTTGAGCCGAGG + Intergenic
1107616913 13:42179500-42179522 GGAATTACAGGCATGAGCCACGG - Intronic
1107734694 13:43386285-43386307 GTCCTTACAGGGATGTGCTGAGG + Intronic
1107867494 13:44716889-44716911 GGAACTACAGGCATGTGCCACGG - Intergenic
1107917119 13:45164043-45164065 GGAATTACAGATGTGTGCTGAGG - Intronic
1108248020 13:48536707-48536729 GGAATTACAGGCATGAGCCATGG - Intergenic
1108933447 13:55860482-55860504 GGAATTACAGGCATGAGCCAAGG - Intergenic
1109068288 13:57729754-57729776 GGAGTTTCAGGCATTTACTAGGG - Intergenic
1109339004 13:61030117-61030139 GGAGTTACATGCAGGTAGTGAGG - Intergenic
1109510281 13:63363123-63363145 GGGATTACAGGCATGAGCCGCGG - Intergenic
1109779703 13:67093182-67093204 GGAATTACAGGCATGAGCCACGG - Intronic
1110147451 13:72208890-72208912 GGAATTACAGGCATGAGCCATGG + Intergenic
1110310937 13:74048130-74048152 GGAGTAAAAGGAATGTACTGGGG + Intronic
1110708368 13:78622171-78622193 GGAATTACAGGCATGAGCCATGG - Intronic
1110846735 13:80198004-80198026 GGAATTACAGGCATGAGCCACGG + Intergenic
1111903967 13:94233894-94233916 ACAGTTTCAGGCATATGCTGAGG + Intronic
1112466945 13:99652923-99652945 AGAGTTGCAGTCATGAGCTGGGG + Intronic
1112538128 13:100281451-100281473 ACAGTTTCAGGCATTTGCTGGGG + Intronic
1113063844 13:106354554-106354576 GGAGGTGCTGGCATCTGCTGAGG - Intergenic
1113111897 13:106832151-106832173 GGGATTACAGGCATGAGCTATGG - Intergenic
1113511954 13:110863553-110863575 GGAGGCACAGGCATGAGCTCAGG - Intergenic
1113877275 13:113602192-113602214 GGAGTTACCCGCAGGAGCTGAGG + Intronic
1115002837 14:28442480-28442502 GGAGTTTCCGGCATGTGATGTGG - Intergenic
1115230205 14:31152458-31152480 GGAGTTACAGGCATGAGCCAAGG + Intronic
1115532985 14:34344046-34344068 GGGATTACAGGCGTGAGCTGCGG - Intronic
1115533770 14:34353263-34353285 GGAATTACAGGCATGAGCCACGG + Intronic
1116460228 14:45164213-45164235 GACATTACAGGCATGAGCTGTGG + Intronic
1116578406 14:46605900-46605922 GGGATTACAGGCATGTGCCACGG + Intergenic
1116689671 14:48089402-48089424 GGGATTACAGGCGTGAGCTGCGG - Intergenic
1116862297 14:50004266-50004288 AGGGTTACAGGCATGAGCCGGGG - Intronic
1116869076 14:50054730-50054752 TTAGTTATAGCCATGTGCTGTGG - Intergenic
1116963962 14:50995120-50995142 GGGATTACAGGCATGAGCTACGG + Intronic
1116986367 14:51223991-51224013 GGACTTACAGGCCTCTGCAGAGG + Intergenic
1117141856 14:52797311-52797333 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1117536384 14:56706976-56706998 GGGATTACAGGCATGAGCTACGG + Intronic
1117610294 14:57476071-57476093 GGGATTACAGGCATGAGCTATGG + Intronic
1117787132 14:59297866-59297888 GAAGTTTCAGGCATCTACTGGGG + Intronic
1117974989 14:61288363-61288385 GGGATTACAGGCATGAGCTGTGG + Intronic
1118713798 14:68544960-68544982 GGAGTTCCAGGGATGGGATGTGG + Intronic
1119054040 14:71400093-71400115 GGGATTACAGGCATCAGCTGAGG + Intronic
1119290083 14:73488750-73488772 GGGATTACAGGCATGAGCCGCGG - Intronic
1120883640 14:89434579-89434601 GGAGTTCCAGGCCTGTGCTCTGG - Intronic
1121807375 14:96841126-96841148 GGGGTTACAGGCATGAGCCATGG + Intronic
1122526035 14:102385125-102385147 GGAATTACAGGCATGAGCCACGG + Intronic
1124022525 15:25937723-25937745 GAAGTTAGAGGACTGTGCTGAGG + Intergenic
1125542985 15:40482119-40482141 GGAACTACAGGCATGTGCCACGG + Intergenic
1126059110 15:44761733-44761755 GAAATTACAGGCATGAGCCGTGG + Intronic
1126418600 15:48446473-48446495 GTGGTTTCAGGCATCTGCTGGGG + Intronic
1126755399 15:51920775-51920797 GGAATTACAGGCGTGAGCTATGG - Intronic
1126945716 15:53817382-53817404 GGGGTTACAGGCGTGAGCCGCGG + Intergenic
1127126300 15:55815575-55815597 GGAATTACAGGCATGAGCCACGG - Intergenic
1127295178 15:57602651-57602673 GGCATTTCAGGCATGTGATGGGG + Intronic
1127327984 15:57913860-57913882 GGTGCTGCAGGCATGTGTTGGGG - Intergenic
1127790775 15:62396973-62396995 GGAATTACAGGCATGAGCCACGG + Intronic
1127976829 15:64003873-64003895 GGAATTACAGGCATGGGCCATGG + Intronic
1128019111 15:64374708-64374730 GGAATTACAGGCATGTGCCATGG - Intronic
1128070716 15:64794968-64794990 GGGGTTACAGGCATGAGCCACGG - Intergenic
1128561803 15:68673565-68673587 GGGATTACAGGCATGTGCCACGG - Intronic
1128569243 15:68721433-68721455 GGGATTACAGGCATGAGCTACGG - Intronic
1128774658 15:70310746-70310768 GGGATTACAGGCATGAGCTACGG - Intergenic
1129151249 15:73689267-73689289 GGAACTAGAGGCATGTGCAGGGG - Intronic
1129346558 15:74924266-74924288 GGAATTACAGGCATGAGCCACGG - Intronic
1130340391 15:82996200-82996222 GGAGTTAAAGGCACGAGCAGTGG - Intronic
1131212062 15:90506279-90506301 GGGATTACAGGCATGAGCCGCGG + Intergenic
1131688593 15:94800461-94800483 GGGATTACAAGCATGAGCTGGGG + Intergenic
1132048616 15:98587815-98587837 GGGATTACAGGTATGAGCTGTGG - Intergenic
1132049289 15:98593501-98593523 GGAATTACAGGCATGTGCCAGGG - Intergenic
1132081986 15:98874080-98874102 GGAGTTATGGGCATGTGATGTGG + Intronic
1132743257 16:1426387-1426409 GAAGGTACAGGCAGGGGCTGAGG + Intergenic
1132857458 16:2053110-2053132 GGAGTTAAAGGGACCTGCTGGGG + Intronic
1132935598 16:2479160-2479182 GGGATTACAGGCATGAGCTACGG + Intronic
1133193926 16:4154874-4154896 GGGATTGCAGGCATGTGCTATGG - Intergenic
1133471362 16:6079168-6079190 GGGATTACAGGCATGTAATGCGG - Intronic
1133827260 16:9289338-9289360 AGAGTTACAGGCATGAGCCATGG - Intergenic
1134165583 16:11926721-11926743 GGGATTACAGGCATGAGCCGTGG + Intergenic
1134386379 16:13777334-13777356 GGAATTACAGGCATAGGCTTGGG - Intergenic
1134483025 16:14634556-14634578 GGGATTACAGGCGTGAGCTGCGG - Intronic
1134495108 16:14726843-14726865 GGGATTACAGGCATGAGCCGTGG - Intronic
1134500492 16:14765963-14765985 GGGATTACAGGCATGAGCCGTGG - Intronic
1134527032 16:14952576-14952598 GGGATTACAGGCATGAGCCGTGG - Intergenic
1134545372 16:15103774-15103796 GGGATTACAGGCATGAGCCGTGG + Intronic
1134580089 16:15363087-15363109 GGGATTACAGGCATGAGCCGTGG + Intergenic
1134714619 16:16351109-16351131 GGGATTACAGGCATGAGCCGTGG - Intergenic
1134722494 16:16394473-16394495 GGGATTACAGGCATGAGCCGTGG - Intergenic
1134944933 16:18317396-18317418 GGGATTACAGGCATGAGCCGTGG + Intergenic
1134952197 16:18357549-18357571 GGGATTACAGGCATGAGCCGTGG + Intergenic
1135310539 16:21401612-21401634 GGGATTACAGGCATGAGCCGTGG + Intergenic
1135448306 16:22537038-22537060 GGGATTACAGGCATGAGCCGTGG - Intergenic
1136469363 16:30468728-30468750 GGGATTACAGGCATGAGCCGTGG + Intergenic
1136531088 16:30869781-30869803 GGGGTTACAGGCATGAGCCATGG + Intronic
1137007827 16:35294881-35294903 GTTGTGACAGGCATGTGCAGTGG - Intergenic
1137014521 16:35361729-35361751 GTTGTGACAGGCATGTGCAGTGG - Intergenic
1137434741 16:48446131-48446153 GGGATTACAGGCATGTGCCACGG - Intronic
1137615311 16:49842703-49842725 GGAATTACAGGCGTGAGCTACGG - Intronic
1137714934 16:50592792-50592814 GGAATTGAAGGCATGGGCTGTGG + Intronic
1137746351 16:50823022-50823044 GGTATTACAGGCATGAGCTTTGG - Intergenic
1137846199 16:51690713-51690735 GGGATTACAGGCATGAGCTATGG - Intergenic
1137889192 16:52140702-52140724 GCAGTTTCAGGCATGCACTGAGG + Intergenic
1139143026 16:64291437-64291459 GGAGTCACAGAAGTGTGCTGTGG - Intergenic
1139728964 16:68926221-68926243 GGAATTACAGGCATGAGCCACGG - Intronic
1141989782 16:87603135-87603157 CGAGTTACATGCATGTCCAGTGG + Exonic
1142301292 16:89259716-89259738 GGGGTTACAGGCATGAGCCACGG + Intergenic
1143039540 17:4023547-4023569 GGGGTTACAGGCATGAGCCATGG - Intronic
1143072084 17:4304783-4304805 GGAAGTAGAGGCTTGTGCTGGGG - Intronic
1143133347 17:4695050-4695072 GGAATTACAGGCATGAGCCACGG - Intronic
1143193377 17:5056848-5056870 GGGGTTACAGGCGTGAGCCGCGG + Intergenic
1143578309 17:7808098-7808120 GGGATTACAGGCATGAGCCGTGG - Intronic
1143672706 17:8407447-8407469 GGGATTACAGGCATGAGCCGCGG + Intergenic
1144527996 17:16007234-16007256 GTCGTTTCAGGCATCTGCTGGGG - Intronic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1145237135 17:21215935-21215957 GGATTTACAGGCATGAGCCACGG + Intergenic
1145842729 17:28009728-28009750 GGCGTTACAGGCATGAGCCATGG + Intergenic
1146011583 17:29198682-29198704 GGGGTTACAGGCATGAGCCATGG - Intergenic
1146250112 17:31332969-31332991 GGGATTACAGGCATGTGCCATGG - Intronic
1147027618 17:37601931-37601953 GGGGTTACAGACATGAGCTACGG + Intronic
1147779054 17:42926574-42926596 GGAATTACAGGCATGAGCCACGG - Intergenic
1148032364 17:44630023-44630045 GGGGTTACAGGCATGAGCCACGG + Intergenic
1149356090 17:55841000-55841022 GCAGTTTCAGGCATTTACTGGGG + Intronic
1150180846 17:63119192-63119214 GGGATTACAGGTATGAGCTGTGG + Intronic
1150577394 17:66442342-66442364 GATGTTACAGGCAGGTGCAGTGG - Intronic
1150598176 17:66625788-66625810 TGAGTTAGAGGCATGGGTTGAGG + Intronic
1150870024 17:68897035-68897057 GTGGTTTCAGGCATCTGCTGGGG + Intronic
1151266220 17:72957546-72957568 GGGATTACAGGCATGAGCTGCGG - Intronic
1151902354 17:77024910-77024932 GGAGAGACAGGCATGTGGTCGGG - Intergenic
1152011077 17:77717677-77717699 GCAGTTTCAGGCATCTACTGGGG + Intergenic
1152897314 17:82920125-82920147 GAAGTGACAGGCATGACCTGTGG + Intronic
1153784744 18:8524672-8524694 GGGATTACAGGCATGAGCCGAGG + Intergenic
1154479700 18:14807800-14807822 GGAGATACAGGCATGAGCCACGG + Intronic
1154480779 18:14821726-14821748 GGAGTTACAGGCATGAGCCATGG + Intronic
1155454190 18:25993630-25993652 GGGATTACAGGCATGTGTGGTGG - Intergenic
1155756031 18:29497691-29497713 AAAGTTACAGCCATGTGCGGTGG - Intergenic
1156325876 18:36074784-36074806 GGGGTTACAGGCGTGAGCTATGG + Intergenic
1158361296 18:56676882-56676904 GGAATTACAGGCATGAGCCAGGG + Intronic
1158983974 18:62794643-62794665 GGGATTACAGGCATGAGCTATGG + Intronic
1159905061 18:74082515-74082537 TCAGTTACAAGCATGTGCAGAGG - Intronic
1160248289 18:77178344-77178366 GGGATTACAGGCATGAGCTGCGG + Intergenic
1160286984 18:77552125-77552147 GGAATTACAGGCATGAGCCACGG + Intergenic
1160536115 18:79593821-79593843 GGAATTACAGGCATGAGCCATGG - Intergenic
1161083569 19:2323349-2323371 GGGGTTCCAGGCGTGAGCTGTGG - Intronic
1161391381 19:4022899-4022921 GGAATTACAGGCATGAGCTACGG - Intronic
1161786941 19:6332541-6332563 GGGGTTACAGGCATGAGCCATGG + Intronic
1162654097 19:12116037-12116059 GGGGTTACAGGCTTGAGCTATGG + Intronic
1162704135 19:12542731-12542753 GGGATTACAGGCATGAGCTATGG - Intronic
1162905167 19:13818832-13818854 GGGATTACAGGCATGAGCCGTGG + Intronic
1163095501 19:15054305-15054327 GGAATTACAGGCATGAGCCATGG - Intronic
1163696396 19:18765688-18765710 GGGATTACAGGCATGAGCTACGG - Intronic
1164063047 19:21691888-21691910 TGAATTACAGCCATCTGCTGAGG + Intergenic
1164139888 19:22449939-22449961 GGAATTACAGGCACGTGCCCTGG + Intronic
1164317158 19:24101113-24101135 GGAATTACAGGCATGAGCCATGG + Intronic
1164684981 19:30160662-30160684 GGAGTGTCAGGCATGTCCTCCGG + Intergenic
1164769236 19:30795539-30795561 GGAGTCAGAGGCAGGGGCTGAGG + Intergenic
1164852429 19:31495572-31495594 GTGGTTTCAGGCATCTGCTGCGG - Intergenic
1164934119 19:32197878-32197900 GGAATTACAGGCATGAGCCACGG + Intergenic
1165508446 19:36250412-36250434 GGAATTACAGGCATGAGCCATGG - Intergenic
1165884262 19:39066477-39066499 GGAGTTACAGGCGTGAGCCACGG - Intergenic
1165995859 19:39843497-39843519 GGGATTACAGGCATGAGCTATGG - Intronic
1165995944 19:39844293-39844315 GGAAGTACTGGCATGTGCTTGGG + Intronic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1166875665 19:45895775-45895797 GGAGTTGGGGGCAAGTGCTGAGG - Intronic
1166978693 19:46620370-46620392 GGGATTACAGGCATGTGCTATGG + Intergenic
1167279727 19:48559848-48559870 GGGATTACAGGCGTGAGCTGTGG - Intronic
1167405200 19:49302125-49302147 GGAGTCAGAGGCAGGGGCTGGGG - Intronic
1167585919 19:50375823-50375845 GGGATTACAGGCGTGAGCTGCGG - Intronic
1167685620 19:50954113-50954135 GGAATTACAGGCATGAGCCACGG + Intergenic
1167893508 19:52561815-52561837 GGAATTACAGGCATGAGCCACGG + Intronic
1167928118 19:52839370-52839392 GGAATTACAGGCATGAGCCATGG + Exonic
1168201436 19:54818501-54818523 GTAGTTCCCTGCATGTGCTGTGG - Exonic
1168380349 19:55915308-55915330 GTAATTACAGCCATGTGCGGTGG + Intronic
925061483 2:894143-894165 GGGGTTACAGGCATGAGCCACGG - Intergenic
925094284 2:1183023-1183045 GGAATTACAGGCATGAGCCATGG + Intronic
927311345 2:21635284-21635306 GGAGTGACAGGGTGGTGCTGGGG + Intergenic
927467587 2:23348684-23348706 GCAGTTTCAGGCATCTACTGGGG - Intergenic
927530363 2:23792315-23792337 GGGATTACAGGCATGAGCTATGG + Intronic
927646819 2:24882784-24882806 GGAATTACAGGCATGAGCCACGG - Intronic
928143375 2:28750488-28750510 GCTGAAACAGGCATGTGCTGTGG - Intergenic
928908103 2:36389869-36389891 GGAGCTACAGGAACGAGCTGTGG - Intronic
929483496 2:42335048-42335070 GGAATTACAGGCATGAGCCACGG - Intronic
929980921 2:46679352-46679374 GGGATTACAGGCATGAGCTACGG - Intergenic
930121788 2:47766740-47766762 GGAATTACAGGCATGAGCCACGG - Intronic
930644826 2:53894540-53894562 GGGATTACAGGCATGTGCCATGG + Intronic
930808162 2:55512672-55512694 GGGATTACAGGCATGAGCTACGG + Intergenic
931284947 2:60824250-60824272 GGGATTACAGACATGAGCTGTGG - Intergenic
931361065 2:61578352-61578374 GGGATTACAGGCATGAGCTATGG - Intergenic
931790378 2:65659032-65659054 GGAATGACAGCAATGTGCTGTGG + Intergenic
932150323 2:69365205-69365227 GGGATTACAGGCATGAGCCGTGG - Intronic
932252919 2:70259778-70259800 GGAATTACAGCCATGGGGTGGGG + Intronic
932569378 2:72930329-72930351 GGAACTACAGGCAGGTGATGGGG + Intronic
932573902 2:72952336-72952358 GGAGATAAAAGCATGTGCTGGGG - Intronic
932886262 2:75551908-75551930 AGAATTACAGGCATGAGCTACGG - Intronic
933219806 2:79675941-79675963 GGAGTTACAGCCAAGTACTCAGG + Intronic
934637880 2:96007627-96007649 GCAGTTTCAGGCATCTGCTAGGG + Intergenic
934674052 2:96237055-96237077 GCAGCCACAGGCATGAGCTGAGG - Intergenic
934719068 2:96560447-96560469 GGGATTACAGGCATGAGCTACGG - Intergenic
934987515 2:98898610-98898632 GGAGCCACAGGCAGATGCTGTGG - Intronic
936708220 2:115101093-115101115 GCAGCCACAGGTATGTGCTGTGG + Intronic
937166199 2:119820129-119820151 GGAATTATAGGCATGAGCCGCGG + Intronic
937250610 2:120521523-120521545 GAAGTGAAACGCATGTGCTGAGG - Intergenic
937277038 2:120691543-120691565 GGAGAGACAGGCAGCTGCTGGGG + Intergenic
937588682 2:123587920-123587942 GTGGTTTCAGGCATCTGCTGGGG - Intergenic
938012376 2:127839236-127839258 GGAATTACAGGCATGAGCCATGG + Intergenic
938013715 2:127849774-127849796 GGGATTACAGGCATGAGCCGCGG - Intronic
938712273 2:133985466-133985488 GTGGTTTCAGGCATCTGCTGGGG - Intergenic
939875854 2:147577024-147577046 GTAGTTGCAGGCATTTACTGGGG + Intergenic
939964245 2:148594991-148595013 GAAATTACAGGCATGTGCCAGGG - Intergenic
940815334 2:158291221-158291243 GGTATTACAGGCATGTGCCACGG + Intronic
940889730 2:159023610-159023632 GGAATTACAGGCATGTGCCATGG + Intronic
941044318 2:160655170-160655192 GGAATTACAGGCATGAGCCGCGG + Intergenic
941403265 2:165057889-165057911 GGAATTACAGGCATGAGCGATGG + Intergenic
942676179 2:178428803-178428825 GGAATTACAGGCATGAGCCACGG + Intergenic
944790048 2:203115698-203115720 GGGATTACAGGCATGAGCTGTGG + Intronic
945450470 2:209989040-209989062 GGAATTACAGGCATGAGCCACGG - Intronic
945545906 2:211151365-211151387 GGACTTACAGACATGAGATGGGG - Intergenic
945732596 2:213557721-213557743 GGGATTACAGGCATGTGCCATGG + Intronic
945760778 2:213911413-213911435 GGGATTACAGGCATGTGCCACGG + Intronic
945852443 2:215025429-215025451 GGAATTACAGGCATGAGCCACGG + Intronic
946379853 2:219339791-219339813 GGAGGGACAGGCATCTGGTGAGG - Intergenic
946843578 2:223839933-223839955 GGGGTTACAGGCATGAGCCACGG - Intergenic
947034964 2:225841957-225841979 GGAATTACAGGCATGAGCCACGG - Intergenic
947464646 2:230331346-230331368 GCAGTTTCAGGCATCCGCTGGGG + Intronic
947553767 2:231069006-231069028 GTGGTTTCAGGCATCTGCTGGGG + Intronic
947760754 2:232602103-232602125 GGGATTACAGGCATGAGCTCCGG + Intergenic
948092987 2:235311276-235311298 GGGATTACAGGCATGAGCTGCGG - Intergenic
948142417 2:235683616-235683638 GGATTGAAAGGTATGTGCTGAGG + Intronic
948446346 2:238036448-238036470 GGGATTACAGGCATGAGCTACGG + Intronic
1169282535 20:4279800-4279822 GGAGCTCCAGGCATCAGCTGGGG + Intergenic
1169286746 20:4314581-4314603 AGAGATACAGGCATCAGCTGTGG + Intergenic
1169438577 20:5614850-5614872 GGGGTTACAGGCATGAGCCATGG + Intergenic
1170628958 20:18052008-18052030 GGGATTACAGGCATGAGCTATGG + Intronic
1170757123 20:19213970-19213992 ACAGTTACAAGTATGTGCTGTGG + Intronic
1170861976 20:20113996-20114018 GGAATTACAGGCATGAGCCATGG - Intronic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1171289676 20:23975130-23975152 GGAGTGACAGGCGAGTGGTGAGG + Intergenic
1171723856 20:28596488-28596510 GGGATTACGGGCATGAGCTGTGG - Intergenic
1171985510 20:31657977-31657999 GGGGTTACAGGCATGAGCCACGG - Intergenic
1172127793 20:32635543-32635565 GGGGTTACAGGCATGAGCCATGG - Intergenic
1172190210 20:33057457-33057479 GGGATTACAGGCGTGAGCTGGGG + Intronic
1172261275 20:33567956-33567978 GGGGTTTCAGGCATCCGCTGGGG + Intronic
1172464549 20:35146565-35146587 GCAGTAACAGGCATCAGCTGTGG - Intronic
1173370947 20:42434689-42434711 GGGATTACAGGCATGAGCCGCGG - Intronic
1173934955 20:46853119-46853141 GAGGTTTCAGGCATCTGCTGAGG - Intergenic
1174017055 20:47497384-47497406 GGGTTTACAGGCATGTGCCACGG + Intergenic
1174379730 20:50148838-50148860 GGGATTACAGGCATGAGCCGCGG - Intronic
1174425769 20:50430759-50430781 TGAGTTGCAGGGATGGGCTGAGG - Intergenic
1174590961 20:51644538-51644560 GGAATTACAGGCATGGGCCATGG + Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176799771 21:13414524-13414546 GGAGTTACAGGCATGAGCCATGG - Intergenic
1176800840 21:13428504-13428526 GGAGTTACAGGCATGAGCCATGG - Intergenic
1176868180 21:14065961-14065983 GGGATTACAGGCATGAGCTACGG + Intergenic
1177836189 21:26188642-26188664 CGAAATACAGTCATGTGCTGAGG - Intergenic
1178303703 21:31473073-31473095 GGAGTTTCAGGCATTTTCTGGGG + Intronic
1178375101 21:32060176-32060198 GATGGTACAGGCAGGTGCTGTGG + Intergenic
1178921600 21:36742526-36742548 GGAATTACAGGCATGAGCCACGG + Intronic
1179311287 21:40198416-40198438 GGGGATCCAGGCATGTGGTGGGG - Intronic
1179422287 21:41246100-41246122 TGAGTTACAGTCACCTGCTGAGG + Intronic
1179520961 21:41944240-41944262 GGGGTTACAGGCGTGAGCCGTGG - Intronic
1180297411 22:10955179-10955201 GGGATTACGGGCATGAGCTGTGG - Intergenic
1180799841 22:18626590-18626612 AGTGTTAGAGGCATGTGCTGGGG + Intergenic
1181221874 22:21368676-21368698 AGTGTTAGAGGCATGTGCTGGGG - Intergenic
1181637263 22:24180316-24180338 AGTGTTAGAGGCGTGTGCTGGGG - Intergenic
1181796055 22:25311918-25311940 GGAAATACAGAGATGTGCTGTGG + Intergenic
1181836599 22:25615528-25615550 GGAAATACAGAGATGTGCTGTGG + Intronic
1182305901 22:29368025-29368047 GGGATTACAGGCATGAGCTGTGG - Intronic
1182548442 22:31088823-31088845 TGAGTGACAGGGAGGTGCTGTGG - Intronic
1182923504 22:34101721-34101743 GCAGTTTCAGGCATCTGCTGAGG - Intergenic
1183689562 22:39381083-39381105 GGGATTACAGGCATGAGCCGCGG + Intronic
1183822463 22:40357521-40357543 GGAATTACAGGCATGAGCCATGG + Intronic
1184066187 22:42123014-42123036 GGGATTACAGGCATGAGCTAAGG + Intergenic
1184150564 22:42635942-42635964 GGGATTACAGGCATGAGCCGTGG - Intronic
1184352268 22:43952146-43952168 GGAGGCACAGGAAGGTGCTGGGG - Intronic
1184473494 22:44708694-44708716 GGGATTACAGGCATGAGCTACGG - Intronic
1185171393 22:49296650-49296672 GGAGTCCCTGGCATGTGCTGGGG - Intergenic
1185324461 22:50218931-50218953 CGAGTGCCAGGCATGTGCTTGGG - Intronic
1185330359 22:50249533-50249555 TGAGATACAGACATGTGCTCAGG - Intronic
949543284 3:5050933-5050955 GGAATTATCGGCATGAGCTGTGG - Intergenic
949557035 3:5163596-5163618 GGGGTTACAGGCATGAGCCATGG - Intronic
950126433 3:10512731-10512753 GGAGTGACAGGGAAGGGCTGTGG - Intronic
950370306 3:12523808-12523830 GGAATTACAGGCGTGAGCCGTGG + Intronic
950396189 3:12735995-12736017 GGAATTACAGGCGTGTGCCCTGG + Intronic
951910651 3:27747005-27747027 GCAGTTAGAGGCAAGGGCTGGGG + Intergenic
952098881 3:29988182-29988204 GGAGGCACAGGCGTGTACTGAGG - Exonic
952326101 3:32321868-32321890 GGAGTTACAGGCGTGAGCCATGG + Intronic
952783735 3:37131102-37131124 ACAGTTTCAGGCATCTGCTGGGG + Intronic
953016688 3:39083561-39083583 GGAATCAGAGTCATGTGCTGAGG + Intronic
953880054 3:46686822-46686844 GAAGTCACAGGCCTGTCCTGTGG - Intronic
954021667 3:47747674-47747696 GGGGTTACAGGCATTTTCTTTGG - Intronic
954228316 3:49197429-49197451 GGGATTACAGGCATGAGCTATGG + Intergenic
954388013 3:50254567-50254589 GGAGTCACAGCCAAATGCTGTGG + Intronic
955508254 3:59653493-59653515 GGGGTTACAGGCATGAGCCAGGG + Intergenic
956795845 3:72717929-72717951 GAAGTTTCAGGCATGCACTGAGG - Intergenic
957290883 3:78276957-78276979 GGTGTTACAGGCATGAGCCATGG - Intergenic
957364623 3:79206545-79206567 GTAGTTTCAGGCATCTACTGGGG + Intronic
957727134 3:84082069-84082091 GGAATTACAGGCATGAGCCATGG + Intergenic
959729264 3:109582359-109582381 GAGATTACAGGCATGTGCCGTGG - Intergenic
959755417 3:109892206-109892228 GGAATTACAGGCATGAGCCACGG + Intergenic
960023070 3:112977280-112977302 GAGGTTACAGGCATGTGATTTGG - Intergenic
960231976 3:115238958-115238980 GGAGATTTAGGTATGTGCTGTGG - Intergenic
960402665 3:117222169-117222191 GGAGTTACAGACCTTTTCTGAGG + Intergenic
961226967 3:125258552-125258574 GTAGTTACAGCCAGGTGCAGTGG - Intronic
961775378 3:129280273-129280295 GGGGTTACAGGCATGAGCCATGG - Intronic
961783461 3:129335314-129335336 GAAGTCACAGGCTTATGCTGGGG - Intergenic
962709491 3:138073413-138073435 AGAGTTACAGGCTGGTACTGGGG - Intronic
965322130 3:167263259-167263281 GGGATTACAGGCATGAGCTATGG + Intronic
965744375 3:171908688-171908710 GCAGTTTCAGGCATGCACTGGGG + Intronic
966327316 3:178771616-178771638 GGAATTACAGGCATGAGCCATGG + Intronic
966520048 3:180863938-180863960 GGGGTTACAGGCATGAGCCATGG - Intronic
966790189 3:183660785-183660807 GGTATTACAGGCGTGAGCTGCGG - Intronic
966870451 3:184287001-184287023 GGGATTACAGGCATGAGCTACGG - Intronic
967073666 3:185983474-185983496 GGAATTACAGGCATGAGCCACGG + Intergenic
967426685 3:189335295-189335317 GGATTTACAGGCATGAGCCATGG + Intergenic
967500154 3:190187945-190187967 GGGGTTACAGGCATGAGCCACGG + Intergenic
967783158 3:193461932-193461954 GGAGTTTCAGCCAAGTGCAGTGG + Intronic
968322924 3:197787372-197787394 GGGATTACAGGCATGAGCTACGG + Exonic
968775898 4:2539826-2539848 GGAATTACAGGCATGAGCCACGG - Intronic
968968322 4:3780735-3780757 AGAGGTGCAGGAATGTGCTGAGG - Intergenic
969043471 4:4319548-4319570 GGGGTTACAGGCATGAGCCATGG - Intronic
969304793 4:6319432-6319454 GAAGTGGCAGGCATGTGCGGAGG - Intergenic
969326183 4:6445564-6445586 GGAGTTTCAGCCAGGTGCTGTGG + Intronic
969356162 4:6627434-6627456 GGAATTACAGGCATGAGCCACGG - Intergenic
969916266 4:10494591-10494613 GGGATTACAGGCATGTGCCATGG + Intronic
970387290 4:15568451-15568473 GGGATTACAGGCATGTGCCCTGG - Intronic
971121624 4:23711090-23711112 GGAATTACAGGCATGAGCCACGG + Intergenic
971195870 4:24471559-24471581 GGAGAGACAGGCATGTGCTCAGG - Intergenic
971560892 4:28078309-28078331 GGAATTACAGGCATGAGCCACGG + Intergenic
971865762 4:32169690-32169712 GGAGTTTTAGGCATCTACTGGGG - Intergenic
974308531 4:60174040-60174062 GGAGTTACAGCCGTGTCTTGGGG + Intergenic
975376918 4:73656990-73657012 GGGATTACAGGCATGTTTTGAGG + Intergenic
975708501 4:77135205-77135227 GGGATTACAGGTATGAGCTGTGG + Intergenic
976362740 4:84199094-84199116 GCAGTTTCAGGCATCCGCTGGGG - Intergenic
976409285 4:84694659-84694681 GGGATTACAGGCATGAGCTACGG - Intronic
977801822 4:101243378-101243400 GGAGTTACAGACTGGGGCTGTGG + Intronic
978775825 4:112506173-112506195 GGGATTACAGGCATGAGCTGTGG - Intergenic
979056893 4:116006863-116006885 GGAATTACAGGCATGAGCCATGG - Intergenic
979923970 4:126536500-126536522 GGGGTTACAGGCATGAGCCATGG + Intergenic
981569534 4:146136968-146136990 GAAGAAACAGACATGTGCTGTGG - Intergenic
981845272 4:149160681-149160703 GTGGCTACAGGCATTTGCTGGGG + Intergenic
981894469 4:149781683-149781705 GCAGTTTCAGACATCTGCTGGGG + Intergenic
982068041 4:151671951-151671973 GTAGTTTCAGGCTTGTTCTGTGG - Intronic
982272111 4:153601259-153601281 GGGATTACAGGCATGAGCTATGG - Intronic
983051455 4:163052384-163052406 GGGATTACAGGCATGAGCTACGG + Intergenic
983170888 4:164535184-164535206 GGAATTACAGGCATGAGCCACGG - Intergenic
983575960 4:169262394-169262416 GGGATTACAGGCGTGAGCTGCGG - Intronic
984369666 4:178846655-178846677 GGAGTTTCAGGCAAGTGTTATGG + Intergenic
985286637 4:188343047-188343069 GGGGTTACAGGCATGAGCCACGG - Intergenic
985319223 4:188690343-188690365 GGGATTACAGGCATGAGCTACGG - Intergenic
985338218 4:188918973-188918995 GGGGTTACAGGCATGAGCTACGG - Intergenic
985369165 4:189266926-189266948 GGAATTACAGGCATGGGCCATGG + Intergenic
985546240 5:510617-510639 GCATTTTCAGGCATTTGCTGAGG + Intronic
985596021 5:788520-788542 TGGGTCACAGGCATGTGATGGGG - Intergenic
986452624 5:7881384-7881406 GGGGGTACAGGCATGTGCTGTGG + Intronic
987616348 5:20279426-20279448 GGAATTACAGGCATGAGCCACGG - Intronic
987989941 5:25197856-25197878 GGAATTACAGGCATGAGCCATGG + Intergenic
988474426 5:31570759-31570781 GGGGTTACAGGCATGAGCCACGG + Intergenic
988602276 5:32650783-32650805 GGGATTACAGGCATGTGCCCTGG + Intergenic
989064091 5:37442305-37442327 GGGATTACAGGCATGAGCTATGG + Intronic
989473760 5:41851029-41851051 GGATTTACAGGCATGAGCCATGG - Intronic
990219388 5:53570952-53570974 GGAATTACAGGCATGAGCCACGG + Intronic
991066617 5:62431110-62431132 GGGACTACAGGCATGTGCTACGG + Intronic
991144015 5:63279989-63280011 GGGATTACAGGCATGTGCCACGG + Intergenic
992399140 5:76395679-76395701 GGAATTACAGGCATGAGCCACGG - Intergenic
992776888 5:80096784-80096806 GGGGTTACAGGCGTGAGCTACGG - Intergenic
993474179 5:88344489-88344511 GGAATTACAGGCATGAGCCACGG + Intergenic
994163974 5:96588468-96588490 GGGATTACAGGCATGAGCTACGG + Intronic
994194867 5:96911613-96911635 GGCCTTACAGGCATGAGCTACGG - Intronic
994417905 5:99498133-99498155 GGGATTACAGGCATGAGCTAGGG + Intergenic
994462059 5:100077019-100077041 GGGATTACAGGCATGAGCTAGGG - Intergenic
996024616 5:118630924-118630946 GCAGTTTCAGGCATCCGCTGGGG - Intergenic
997054813 5:130429306-130429328 GGAATTACAGGCATGAGCTACGG - Intergenic
997449964 5:133974680-133974702 GGAATTACAGGCATGAGCCATGG - Intronic
997924420 5:138015430-138015452 GGAATTACAGGCATGAGCCATGG - Intronic
998805828 5:145917169-145917191 GGAGTAACAGGCAAATACTGTGG - Intergenic
998852041 5:146360389-146360411 GGAGAGCCAGGGATGTGCTGGGG + Intergenic
1000858965 5:166433574-166433596 GGAGTGAGAGGCATCTGCTGTGG - Intergenic
1003116982 6:3289553-3289575 GGATTTACACGCCTGGGCTGGGG + Intronic
1004602998 6:17168829-17168851 GGATTTACAGGCATGAGCCACGG - Intergenic
1005291279 6:24381672-24381694 GGAATTACAGGCATGAGCCATGG - Intergenic
1005474181 6:26191219-26191241 GGAGTTACAGGCATAAGCCATGG - Intergenic
1005971591 6:30766057-30766079 GGAATTACAGGCATGAGCCACGG + Intergenic
1006103861 6:31704097-31704119 GGAATTACAGGCATGAGCCATGG - Intronic
1006533450 6:34677676-34677698 GGGATTACAGGCATGAGCCGTGG - Intronic
1006647775 6:35526864-35526886 GGAGTTACAGGCATGAGCCATGG - Intergenic
1007135683 6:39519748-39519770 GAATTTACAGGCATGAGCCGCGG - Intronic
1007331575 6:41114687-41114709 GGAGTTACAACAATGTGCTATGG + Intergenic
1007773329 6:44208559-44208581 GGAGTTTAAGGAATTTGCTGAGG - Intergenic
1008337860 6:50328055-50328077 GGGATTACAGGCATGAGCTATGG - Intergenic
1008509923 6:52266756-52266778 GTAGTTAGAGGCACGTGATGGGG - Intronic
1009279027 6:61722977-61722999 GGAATTACAGGCATGAGCTGCGG + Intronic
1009342454 6:62572759-62572781 GCAGTTTCAGGCATGCACTGGGG + Intergenic
1009442635 6:63699857-63699879 GGCATTACAGGCGTGAGCTGCGG + Intronic
1010711243 6:79177256-79177278 GTAGTTTCAGGGATATGCTGGGG + Intergenic
1011806717 6:91080383-91080405 AGACTTAGAGGCATGTGTTGAGG + Intergenic
1012019219 6:93895095-93895117 GTGGTTACAGGCATCTACTGGGG + Intergenic
1012810902 6:103956822-103956844 GGGATTACAGGCATGAGATGCGG - Intergenic
1012911935 6:105127704-105127726 GGGATTACAGGCATGAGCTATGG + Intronic
1014235364 6:118948205-118948227 GGGATTACAGGCATGTGCCATGG + Intergenic
1015566251 6:134574537-134574559 GGAATTACAGGCATGAGCCACGG + Intergenic
1016238181 6:141893372-141893394 GGTGTTACAGGCATGAGCCAAGG - Intergenic
1016406021 6:143731555-143731577 GGGATTACAGGCATGAGCTACGG + Intronic
1016453865 6:144211203-144211225 GCAGTTTTAGGCATTTGCTGGGG - Intergenic
1016642112 6:146361056-146361078 GAAGTTACAGGCAGCTACTGAGG + Intronic
1017260815 6:152384603-152384625 GGAATTACAGGCATGAGCCATGG - Intronic
1017782225 6:157724398-157724420 GAAGTTACAGCTATATGCTGTGG - Intronic
1018159046 6:161019677-161019699 GGGATTACAGGCGTGAGCTGTGG + Intronic
1019355828 7:578320-578342 GGAGCTCCCGGGATGTGCTGGGG - Intronic
1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG + Intergenic
1019848118 7:3527362-3527384 GGAGATGAAGGCATGTGCTGTGG + Intronic
1019880693 7:3858279-3858301 GGGATTACAGGCATGTGCCACGG - Intronic
1020262463 7:6538095-6538117 GGAGTTACAGGCATGAGCCACGG - Intronic
1020691287 7:11357643-11357665 GGGATTGCTGGCATGTGCTGGGG + Intergenic
1020755971 7:12203332-12203354 GGAATTACAGGCATGAGCCACGG - Intergenic
1020994769 7:15249672-15249694 AGAGTTACAAGGATGTGATGGGG + Intronic
1021695605 7:23273069-23273091 GGTATTACAGGCATGAGCCGGGG + Intronic
1022536426 7:31101432-31101454 GGGGCCACAGGCATGTTCTGGGG + Intronic
1022546010 7:31189831-31189853 GGGATTACAGGCATGAGCCGTGG + Intergenic
1023405070 7:39825138-39825160 ACAGTTTCAGGCATTTGCTGGGG - Intergenic
1023853910 7:44168849-44168871 GGAATTACAGGCATGAGCCATGG + Intronic
1024814466 7:53252918-53252940 GGGGTTACATGGATGTCCTGTGG - Intergenic
1026495775 7:70901748-70901770 GGAATTACAGGCATGAGCCACGG - Intergenic
1026857142 7:73762394-73762416 GGATTTGCAGGCATGGGCAGAGG - Intergenic
1027025372 7:74848058-74848080 GCAGTTCCAGGCATCCGCTGAGG - Intronic
1027062391 7:75096061-75096083 GCAGTTCCAGGCATCCGCTGAGG + Intronic
1027618862 7:80457945-80457967 GGAATTACAGGCATGAGCCACGG - Intronic
1027622693 7:80510647-80510669 GTAGTTACTGACAAGTGCTGTGG + Intronic
1028029627 7:85894214-85894236 AGAAGTAGAGGCATGTGCTGAGG + Intergenic
1028042448 7:86071575-86071597 GGGATTACAGGCATGAGCAGTGG - Intergenic
1028184035 7:87759724-87759746 GGAGTTTGAGGCATGAGCTGTGG + Intronic
1029479974 7:100806471-100806493 GGAGTTACGGGATTGTGATGTGG - Exonic
1031018105 7:116597376-116597398 GGTGTTAGAGTCACGTGCTGGGG - Intergenic
1031447489 7:121872902-121872924 GGAGTTAGAGGGATCCGCTGGGG - Intergenic
1031621647 7:123940764-123940786 GGAATTACAGCCATGAGCTATGG + Intronic
1031926663 7:127645017-127645039 GCAGTTTCAGGCATCTGCTGGGG + Intergenic
1032157524 7:129481226-129481248 GGGATTACAGGCATGAGCTACGG - Intronic
1032463787 7:132130673-132130695 GAAGCCACAGGCATGTGCAGGGG + Intronic
1032464000 7:132132169-132132191 GAAGACACAGGCATGTGCAGGGG - Intronic
1032664991 7:134027387-134027409 GGGGTTACAGGCATGAGCCACGG - Intronic
1033956165 7:146851253-146851275 GGAATTACAGGCATGAGCCACGG + Intronic
1034121802 7:148634864-148634886 GGAATTTCAGCCAGGTGCTGTGG - Intergenic
1034146300 7:148875886-148875908 GGGATTACAGGCATGAGCCGCGG - Intronic
1034759425 7:153657451-153657473 GGAGTTACAGGCAGGTGTATGGG + Intergenic
1035726340 8:1826492-1826514 GGAGTTACAGACCTGGGTTGAGG + Intronic
1035945269 8:3954838-3954860 GGAGTTACATGCATGTGCATTGG + Intronic
1036146788 8:6261457-6261479 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1036557484 8:9872973-9872995 GGAATTACAGGCGTGAGCTATGG + Intergenic
1037109134 8:15144725-15144747 GGGGTTACAGGCATGAGCAACGG + Intronic
1037403860 8:18521321-18521343 GGAGTTATAGGCAGGTTCTCTGG + Intergenic
1037941785 8:22956928-22956950 GGAATTACAGGCATGAGCTACGG + Intronic
1037981230 8:23255895-23255917 GGAATTACAGGCATGCGCCACGG + Intronic
1038498355 8:28023313-28023335 GGAGTTACAGTGATGTCCCGGGG + Exonic
1038581497 8:28752649-28752671 GGAGCTACAGGCTGATGCTGGGG - Exonic
1039263348 8:35797298-35797320 GGGATTACAGGCATGTGCCATGG - Intergenic
1039267258 8:35839346-35839368 GGGATTACAGGCATGAGCTACGG + Intergenic
1039373895 8:37013998-37014020 GGAGAAACAGGCGAGTGCTGAGG + Intergenic
1039396145 8:37226865-37226887 GGGATTACAGGCATGAGCCGTGG + Intergenic
1039534938 8:38301239-38301261 GGAATTACAGGCATGAGCCATGG + Intronic
1040032598 8:42839924-42839946 GGGATTACAGGCATGAGCCGTGG - Intronic
1040279595 8:46032320-46032342 GGGGTGACAGGCGTGGGCTGCGG - Intergenic
1041094187 8:54332943-54332965 GGAATTACAGGCATGAGCCATGG + Intergenic
1042977244 8:74482924-74482946 GGAGTTACAGACATGGGCTCTGG + Intronic
1043056268 8:75443629-75443651 GGGATTACAGGCATGTGCTCTGG + Intronic
1043141730 8:76598876-76598898 GTAGTTAAAGGCATGGGCTCTGG - Intergenic
1043236457 8:77874263-77874285 GGGATTACAGGCATGTGCCATGG + Intergenic
1043483933 8:80680319-80680341 GGAGTTAACGTCATGTTCTGAGG + Intronic
1043620821 8:82190858-82190880 GAAGTTTCAGGCATCTACTGGGG + Intergenic
1043676440 8:82961666-82961688 GGAATTACAGGCATGAGCCATGG + Intergenic
1044727039 8:95202412-95202434 GAAGTTTCAGGCATCTGCTAGGG - Intergenic
1044892207 8:96849504-96849526 GGGTTTACAGGGATGTGCTTAGG - Intronic
1045160611 8:99539473-99539495 GGAATTACAGGCATGAGCCATGG - Intronic
1045531055 8:102985794-102985816 GGGATTACAGGCATGAGCTATGG - Intergenic
1045624993 8:104034738-104034760 GGAATTACAGGCATGAGCTACGG + Intronic
1045737592 8:105315532-105315554 GTAGTTTCAGGCATTTACTGAGG + Intronic
1046105929 8:109666468-109666490 GGGATTACAGGCATGAGCAGTGG - Intronic
1047114678 8:121828025-121828047 GGGATTACAGGCATGAGCTACGG + Intergenic
1047512078 8:125523080-125523102 GGAATTACAGGCATGAGCCATGG - Intergenic
1047535752 8:125718315-125718337 GGAGATACAGGGAAGCGCTGAGG + Intergenic
1047705851 8:127499016-127499038 GGAGTTAAGGGCCTCTGCTGAGG + Intergenic
1047792050 8:128213314-128213336 TCAGTTACAGACATGTGCAGAGG + Intergenic
1048731169 8:137442281-137442303 GGGGTTCCAGGCTTGTGGTGGGG + Intergenic
1049044847 8:140141452-140141474 ACAGTTTCAGGCATCTGCTGGGG + Intronic
1049107183 8:140621477-140621499 TGAGTGACAGCTATGTGCTGGGG - Intronic
1049632097 8:143664416-143664438 GGAGCCACAGGCATGGGCTTGGG + Intergenic
1049819846 8:144626919-144626941 GGAGTTTCAGGGATGTCTTGTGG - Intergenic
1050319205 9:4433824-4433846 GGGATTACAGGCATGAGCAGCGG - Intergenic
1050440380 9:5655569-5655591 GGGATTACAGGCATGAGCCGTGG + Intronic
1050738730 9:8794612-8794634 GGAGCTACAGGCATGTGTCATGG + Intronic
1053353728 9:37429929-37429951 GGAGCTCCAGGCATGTCCAGGGG + Intronic
1053538482 9:38949312-38949334 GGGATTACAGGCATGAGCTACGG - Intergenic
1054627656 9:67414607-67414629 GGGATTACAGGCATGAGCTACGG + Intergenic
1055464814 9:76554116-76554138 GGGGTTACAGGCATGAGCCATGG - Intergenic
1055952640 9:81744522-81744544 GGGATTACAGGCATGTGCCACGG + Intergenic
1056113967 9:83423864-83423886 GGGATTACAGGCATGAGCCGCGG + Intronic
1057187978 9:93068837-93068859 GAAGTTTCAGGCATGCACTGAGG - Intronic
1057377334 9:94537013-94537035 GGGATTACAGGCATGAGCTACGG - Intergenic
1057710299 9:97435357-97435379 GGAATTACAGGCATGAGCCATGG - Intronic
1059155719 9:111986801-111986823 GGGATTACAGGCATGAGCCGCGG + Intergenic
1059203873 9:112445147-112445169 GGGATTACAGGCATGAGCTATGG + Intronic
1059210536 9:112510770-112510792 GGAGTGCCAGGCATGTGTAGGGG + Intronic
1059474138 9:114530476-114530498 GGAATTACAGGCATGAGCCATGG - Intergenic
1059718134 9:116932572-116932594 AGAGTTACATGCATGTGCCCTGG + Intronic
1059878607 9:118664425-118664447 GGGATTACAGGCATGAGCCGCGG + Intergenic
1060591496 9:124819934-124819956 GGAATTACAGGCATGAGCCATGG + Intergenic
1061024394 9:128038493-128038515 GGGGTTACAGGCATGAGCCACGG - Intergenic
1061036291 9:128116041-128116063 GGGATTACAGGCATGAGCCGCGG - Intergenic
1061074314 9:128331998-128332020 GGATTTACAGGCATGAGCCTCGG + Intronic
1061536207 9:131251880-131251902 GGGATTACAGGCATGAGCCGTGG + Intergenic
1062258300 9:135642100-135642122 GGGATTACAGGCATGAGCTACGG - Intergenic
1062370300 9:136235319-136235341 GGACTGACAAGCATGTGCTGGGG + Intronic
1062550688 9:137085009-137085031 TGGGTCACAGGCATGTGGTGGGG + Intergenic
1203449071 Un_GL000219v1:93410-93432 GGGATTACAGGCATGAGCTGTGG - Intergenic
1185455192 X:306032-306054 GGGGTTACAGGCCTGTGCCACGG + Intronic
1185549886 X:974614-974636 GGAATTACAGGCATGAGCCACGG + Intergenic
1186714200 X:12232860-12232882 GGAGTTATAGGCAAGTGCACAGG + Intronic
1187075661 X:15931834-15931856 GGAATTACAGGCGTGCACTGTGG + Intergenic
1187341004 X:18421581-18421603 GGGATTACAGGCATGAGCCGCGG - Intergenic
1187463257 X:19506202-19506224 GGAGTTACAGGCATGAACCACGG + Intronic
1187683062 X:21787484-21787506 GGAATTACAGGCATGAGCCACGG + Intergenic
1188133478 X:26466756-26466778 GGGGTCATATGCATGTGCTGTGG - Intergenic
1189476616 X:41361012-41361034 GGAATTACAGGCATGAGCCACGG + Intronic
1190127873 X:47722332-47722354 GGTGTTACAGGCAAGGTCTGAGG - Intergenic
1190814567 X:53918060-53918082 GGAATTACAGGCATGAGCCATGG + Intergenic
1192105376 X:68310982-68311004 GGAATTACAGGCATGAGCCATGG - Intronic
1192875946 X:75229942-75229964 GAAGTTGCAGGCAGGTGGTGAGG + Intergenic
1194795089 X:98201290-98201312 GGGATTACAGGTATGAGCTGTGG + Intergenic
1195305325 X:103576491-103576513 GGGATTACAGGCGTGAGCTGCGG - Intronic
1195628418 X:107028771-107028793 GGGATTACAGGCATGAGCCGTGG - Intergenic
1196343187 X:114621149-114621171 GGAATTACAGGCATGAGCTATGG + Intronic
1196697321 X:118626957-118626979 GGGATTACAGGCATGTGCCACGG - Intronic
1196757617 X:119171777-119171799 GGAATTACAGGCATGAGCCACGG + Intergenic
1197520806 X:127494208-127494230 GGAATTACAGGCATGAGCCATGG - Intergenic
1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG + Intronic
1198260854 X:134963692-134963714 GGGATTACAGGCATGAGCTATGG - Intergenic
1199608538 X:149595062-149595084 CGAGTGTCAGTCATGTGCTGGGG - Intergenic
1199630584 X:149774298-149774320 CGAGTGTCAGTCATGTGCTGGGG + Exonic
1200381169 X:155838567-155838589 GGGATTACAGGCATGTGCCACGG - Intergenic
1200908172 Y:8507068-8507090 GGAATTACAGGCATGAGCCACGG + Intergenic
1201340610 Y:12928996-12929018 GGGATTACAGGCATGAGCTACGG - Intergenic
1201758813 Y:17516847-17516869 GGAGTTTGAGGAGTGTGCTGAGG - Intergenic
1201842742 Y:18389143-18389165 GGAGTTTGAGGAGTGTGCTGAGG + Intergenic