ID: 1145117657

View in Genome Browser
Species Human (GRCh38)
Location 17:20226319-20226341
Sequence TAGTAAGCATAGTATTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145117657 Original CRISPR TAGTAAGCATAGTATTGTAG AGG Intronic
901284861 1:8069582-8069604 TAGTGTGCATAGTACTGAAGGGG + Intergenic
901819659 1:11819632-11819654 CAGTAAGCATAGTATTAGAAGGG + Intronic
902162502 1:14542658-14542680 TAGTGAGCATAGTATCGGATAGG + Intergenic
906637475 1:47418859-47418881 TAGTATGCATAGTATTCTGGAGG + Intergenic
909485208 1:76165048-76165070 TATTAAGCCTAGTATTATATAGG + Intronic
909577904 1:77195935-77195957 TACTAAGCATAGTATTCAATAGG + Intronic
909657683 1:78049019-78049041 TAGTACGCATAATATTTCAGTGG + Intronic
910910748 1:92231204-92231226 TGGGAAGCATAGTATTGAATAGG + Intronic
911067692 1:93806138-93806160 AAGGAAGCATAGTGTTGAAGAGG + Intronic
911632468 1:100198983-100199005 TAATAAACATGGTATTGAAGTGG + Intronic
911771451 1:101747782-101747804 TAGTGAGCATAGTATTCAATAGG - Intergenic
913463464 1:119114631-119114653 TAGTAATCAGAGTATAGTTGAGG + Intronic
914433086 1:147637261-147637283 CATTAGGCAAAGTATTGTAGAGG - Intronic
916535846 1:165702303-165702325 TAGTAAACATACTATTGTTCAGG - Intergenic
918669789 1:187200725-187200747 TAGTGAGCATAGTATTCAATAGG - Intergenic
919415734 1:197306558-197306580 TGGCAAGCTTAGGATTGTAGTGG + Intronic
1064398166 10:14998047-14998069 TATTATTCATAGTATTCTAGGGG + Intergenic
1064666166 10:17654141-17654163 TAGTTAGCAGTGCATTGTAGAGG + Intronic
1065193460 10:23236993-23237015 TAGTAAGCATAGTATCCGACAGG + Intronic
1066153157 10:32646692-32646714 TAGTAAGCATAGTACTACATAGG + Intronic
1068367352 10:56068290-56068312 TAATTATCATAGTCTTGTAGGGG + Intergenic
1069288353 10:66744731-66744753 TGGTAAGCATTTTATTTTAGGGG - Intronic
1072903803 10:99432013-99432035 TAGTAAGCATAGTACTTGACAGG + Intergenic
1073868723 10:107836122-107836144 TAGTAAACATACTATTGAAAAGG + Intergenic
1074516617 10:114176107-114176129 TAGGAAGCTTCGTATTGTAATGG + Intergenic
1074730671 10:116371147-116371169 AAGTAAGCATATTATTGCTGGGG - Intronic
1074790754 10:116885089-116885111 TGGTAAGCATAGGCTTGAAGAGG - Exonic
1077829647 11:5852482-5852504 TAGTAAGCATAGTACTCAATAGG + Intronic
1079536701 11:21523642-21523664 TATAAAGCAGAGTATTGGAGAGG - Intronic
1079639151 11:22782514-22782536 TAGTAAGCATAGTATCCAACAGG + Intronic
1080440157 11:32286593-32286615 TAATAAGCATAGTACTGTACAGG - Intergenic
1082235315 11:49815901-49815923 TATTATTCATAATATTGTAGGGG + Intergenic
1090095212 11:123736052-123736074 TAGGATGCATAGGATTGGAGAGG + Intronic
1090143284 11:124289717-124289739 TAATAAGCATAGTATCGGATAGG + Intergenic
1094444758 12:30517728-30517750 TGGTATGCAAAGCATTGTAGAGG - Intergenic
1095186320 12:39204445-39204467 TAATAAGCATAGTATTCAATAGG - Intergenic
1096662800 12:53139088-53139110 AAGTAAGGACAGTATTGTGGAGG - Intergenic
1096936676 12:55287726-55287748 TAGTGAGCATAGTATTTGATAGG - Intergenic
1097013486 12:55969387-55969409 GAGTAAGCAGAGTAGTGTTGAGG + Intronic
1097621124 12:61940826-61940848 TCATAACCATAGTATTCTAGTGG - Intronic
1099180972 12:79472528-79472550 TAGTAATCCCAATATTGTAGGGG + Intergenic
1101204745 12:102475479-102475501 AAGTAAGCATAGTGTTTTGGCGG - Intronic
1103029660 12:117602519-117602541 TACTAAGTATAGTATTTTTGAGG + Intronic
1103484832 12:121275549-121275571 CAGTTAGCATAATATTTTAGAGG - Intronic
1105732903 13:23236929-23236951 TAGGAAGCATAGTTTTGTTCTGG - Intronic
1107680930 13:42849433-42849455 CAGAAAGCATAATGTTGTAGAGG - Intergenic
1108007788 13:45969381-45969403 TGGTAAGAATGGTATTCTAGAGG - Exonic
1108130424 13:47293489-47293511 TAATAAGCATAGTATTTGATAGG + Intergenic
1108837385 13:54568642-54568664 TGGTAATCATAGTATTATAGAGG + Intergenic
1109036467 13:57268156-57268178 TAGTAAGCATAGTACCGGATAGG + Intergenic
1109102497 13:58203238-58203260 TACTAAGTATAGTAATGTTGTGG + Intergenic
1109509902 13:63357146-63357168 TAGTAACCGTAGTAATATAGAGG - Intergenic
1109553542 13:63938098-63938120 TATTCAACATAGTATTGTATTGG + Intergenic
1110582512 13:77147808-77147830 TAGTGAGCCAAGTATTGTAGAGG - Intronic
1110732990 13:78902434-78902456 TAGTAAGCATAGTACTTTACAGG - Intergenic
1111899653 13:94185179-94185201 TAGTAAGCATAGTATCCAATAGG - Intronic
1111972390 13:94930366-94930388 TAGTAAGCATAGTACTCAATGGG + Intergenic
1111994779 13:95154795-95154817 TAACAAGCCTATTATTGTAGAGG + Intronic
1112999772 13:105620646-105620668 TTTTAATGATAGTATTGTAGTGG - Intergenic
1116755005 14:48936765-48936787 TAATAAACATAGTACTCTAGGGG - Intergenic
1120576041 14:86182064-86182086 TAGTAAGCATAGTATGTGATAGG + Intergenic
1124826831 15:33105367-33105389 TATTAAAAATAGGATTGTAGGGG + Intronic
1133465472 16:6022923-6022945 TTTTAAGGATAGTATTGTATAGG + Intronic
1135875307 16:26194052-26194074 TAGTAATAACAGTATAGTAGCGG + Intergenic
1138330131 16:56206840-56206862 TTGTAAGCACAGCATTGAAGGGG - Intronic
1139120847 16:64014535-64014557 TAGTATGCAAAGTATGGTGGAGG - Intergenic
1140009902 16:71120911-71120933 TGGAAAGCATAGTATTTGAGTGG - Intronic
1140654737 16:77127942-77127964 TAGTAAGCATAGTACCCAAGAGG - Intergenic
1140831295 16:78753882-78753904 AAGGAAGCATAGAATTGAAGAGG + Intronic
1141005956 16:80351862-80351884 TAGTAAGCCAAGTGCTGTAGTGG - Intergenic
1144355962 17:14446624-14446646 TAGTAATCAAAGTATTTTAAGGG - Intergenic
1145117657 17:20226319-20226341 TAGTAAGCATAGTATTGTAGAGG + Intronic
1145121494 17:20264341-20264363 TAGTAAGCATAGTACTCTGTAGG + Intronic
1149079389 17:52635472-52635494 TAGTAAGCATAGTATTCAAAAGG - Intergenic
1149194891 17:54107869-54107891 TAGTAAGCATAGTATCCAATAGG - Intergenic
1149935768 17:60805366-60805388 ATGTAACCACAGTATTGTAGGGG + Intronic
1149940761 17:60863276-60863298 TAGTCAGGATAGTATGGTACTGG - Intronic
1153443534 18:5147506-5147528 TAGTGAGCATATTCGTGTAGAGG - Intronic
1156170144 18:34472870-34472892 TACTAAACATTGTATTCTAGTGG - Intergenic
1156618744 18:38822385-38822407 TAATAAGCATAGTATCCTATAGG - Intergenic
1156994701 18:43451096-43451118 TAGTAAGCATAGTACTCAATAGG - Intergenic
1160147690 18:76378339-76378361 TAGTAAGCAAAGCTTTGCAGAGG - Intronic
1165442412 19:35837207-35837229 TGATAGGCACAGTATTGTAGTGG - Intronic
1165610792 19:37150378-37150400 TAGAAACCATTGTATTGCAGGGG + Exonic
926559283 2:14398011-14398033 AAGTAAGCATAGTCTTTTATAGG + Intergenic
926650513 2:15339037-15339059 TATTAAGCATACTATTTCAGGGG + Intronic
926854112 2:17233553-17233575 TAATAAGCATAGTATTTGATTGG - Intergenic
927047373 2:19293106-19293128 TCTTAAACATAGTATTTTAGAGG + Intergenic
928314245 2:30233407-30233429 TAGTAACCATACAATTGAAGAGG + Intronic
928769658 2:34691671-34691693 TAGTAAGCATAGTATTCTATAGG + Intergenic
929002829 2:37364993-37365015 TAATAATAATAATATTGTAGAGG - Intronic
931006696 2:57857911-57857933 TAGTAAGCATAGTATCCAATAGG + Intergenic
931014669 2:57962523-57962545 TAATAAGCATAGTATTTGATCGG + Intronic
933408043 2:81887866-81887888 TAGTTAGCATAGTACTGAATAGG + Intergenic
938623402 2:133081987-133082009 TAGTAAGCATAGTACTTGATAGG + Intronic
939053928 2:137339442-137339464 TAGAAAGCACAGTATTGTGAGGG + Intronic
940284721 2:152022743-152022765 TAGAAAGCATAATATTCTACTGG + Intronic
940595961 2:155793505-155793527 TGGTAAGTATACTATTCTAGTGG + Intergenic
940871498 2:158864327-158864349 TATTATTCATAGTATTCTAGGGG - Intergenic
941310756 2:163927922-163927944 TAGTGAGCATAGTATTCGATAGG - Intergenic
942860622 2:180606110-180606132 AAATAATCATTGTATTGTAGTGG + Intergenic
944418348 2:199501452-199501474 AAGACAGCATGGTATTGTAGGGG - Intergenic
944738095 2:202586505-202586527 TATTATGCATACTATTCTAGGGG + Intergenic
944927954 2:204484840-204484862 TAGGAAGAATAGTCTGGTAGTGG - Intergenic
945056453 2:205873488-205873510 TAGAGAGTATAGTTTTGTAGTGG - Intergenic
945579999 2:211581460-211581482 TGGTAAGCATAGGCTTGAAGAGG - Intronic
946494925 2:220186527-220186549 AACTAAACATAGTAATGTAGTGG - Intergenic
948130099 2:235594084-235594106 TAGTAAGGATAGTTTTCAAGCGG + Intronic
1169027508 20:2383168-2383190 TACTAAGCATAGGATTATAATGG + Intronic
1169891123 20:10453089-10453111 TCGTAAGCATAATATTGTTTAGG + Intronic
1176924168 21:14726548-14726570 GAGAAAGCATAGTATTGTGTTGG - Intergenic
1182055836 22:27353960-27353982 TAATAAGCATAGTACTGAATAGG + Intergenic
949886826 3:8702079-8702101 TATTATTCGTAGTATTGTAGGGG - Intronic
954738949 3:52731430-52731452 CAGTAAGCAAAGTGTGGTAGTGG + Intronic
957477674 3:80747855-80747877 TAATAAGCATAGTATTCGATAGG + Intergenic
957862948 3:85981459-85981481 TAGTAAGCATAGTATGTGATAGG + Intronic
958488497 3:94742964-94742986 TAGTAAGCATAGTACTTGATAGG - Intergenic
960293606 3:115915922-115915944 AAGTCAGCATAGTGTTCTAGGGG - Intronic
960868666 3:122227766-122227788 TAGTGAGCATAGTATACTATAGG - Intronic
963750540 3:149174595-149174617 CAGTAAGCAAACTATTGTATTGG + Intronic
964935876 3:162086375-162086397 TAGTAAGCATAGTACTCAATAGG - Intergenic
966690392 3:182735582-182735604 TAGTAAGCACTCTATTGTAAAGG + Intergenic
969225296 4:5793152-5793174 TAGTAAGCATGGTATTGGTGCGG + Intronic
973767447 4:54176099-54176121 TAGTAAGCATAGTGCTCTATAGG - Intronic
974410909 4:61539767-61539789 TGGTAAGCATATTGTTGCAGGGG + Intronic
974637840 4:64588809-64588831 TAGTGAGCATAGTACTGAATAGG - Intergenic
977033169 4:91914309-91914331 CAGAAAGCAGAGTATTGCAGAGG + Intergenic
977058788 4:92229353-92229375 TAGTAAGCATAGTACTCCATAGG - Intergenic
978624520 4:110669445-110669467 AAGTAAGCATAGGATTTTAGGGG - Intergenic
978752458 4:112266212-112266234 CTGGAAGCATAGTATGGTAGTGG + Intronic
978866249 4:113515125-113515147 TAGTAAGCATTTTATTGATGAGG + Exonic
981320927 4:143390430-143390452 TAGGAAGCACACTAGTGTAGTGG + Intronic
981353986 4:143765934-143765956 TAGTGAGCATAGTATGCAAGAGG + Intergenic
982079429 4:151773494-151773516 TAGTTAACACAGTATTGTATTGG - Intergenic
983824184 4:172236820-172236842 TAATAAGCATAGTATTCAATAGG + Intronic
987294765 5:16539990-16540012 TAGTAAGCTTTATATTTTAGAGG - Intronic
988954654 5:36303029-36303051 TAATAAGCATATTATTATACAGG + Intergenic
992434438 5:76741752-76741774 TAGTAAGCATAGTACTCGATAGG - Intergenic
993252064 5:85540217-85540239 TAGTGAGCATAGTATCCTATAGG - Intergenic
994023220 5:95051922-95051944 TAATAAGCATAGTACTGGATGGG - Intronic
994396711 5:99231345-99231367 TATTAATCATAATATTCTAGGGG + Intergenic
996848723 5:127929695-127929717 TAGTAATAATAGTATTGTTAGGG - Intergenic
998653147 5:144143709-144143731 GATTAACCATAGTACTGTAGAGG + Intergenic
999539409 5:152555330-152555352 TAGTGAGCATAGTATTCAATAGG - Intergenic
1000354088 5:160376776-160376798 AAGAAAGCATATCATTGTAGAGG - Intergenic
1000734259 5:164879441-164879463 TAATAAGCACAGTATCCTAGAGG - Intergenic
1004419037 6:15451280-15451302 GAGTTAGCATAGGATTGTAATGG + Intronic
1004572348 6:16859557-16859579 TAGTAACCATGGGATTGAAGGGG - Intergenic
1004954576 6:20714986-20715008 TAGTAAAAATATTATTATAGTGG + Intronic
1005234660 6:23746006-23746028 TATTAAGCATACTATTCTATGGG - Intergenic
1005299770 6:24459004-24459026 AAGTAGGCATTGGATTGTAGTGG - Intronic
1007995124 6:46299135-46299157 TAGTGAGCATAGTACTGGATAGG - Intronic
1008909578 6:56718769-56718791 TAGTTAGCATAATATTTTTGAGG - Intronic
1009364548 6:62847871-62847893 TATTAAGAACAATATTGTAGGGG + Intergenic
1011176681 6:84569250-84569272 TAGTAAGCATAGCATTCTTATGG - Intergenic
1014355090 6:120398574-120398596 TTGTAAGCATAGTACTGAATAGG - Intergenic
1014437085 6:121432529-121432551 TTGTAAGAAGAGTATTGTAATGG - Intergenic
1014593393 6:123301199-123301221 TATTGAGAATAGAATTGTAGTGG + Intronic
1015192060 6:130482451-130482473 TAGTAAGCATAGTATCCAATAGG - Intergenic
1017221908 6:151975308-151975330 TACTAAGCACAATATTGTAAAGG - Intronic
1020724364 7:11791562-11791584 TAGGAAGAAAAGTTTTGTAGAGG + Intronic
1023299253 7:38751659-38751681 TAGTAAGCAGATAATTATAGTGG + Intronic
1024483189 7:49886339-49886361 CAGGAAGCTTAATATTGTAGAGG - Intronic
1025966637 7:66279036-66279058 TAATAAGCATAGTACTCTATGGG + Intronic
1028860684 7:95646796-95646818 TAGTAAGCATAGTACCCAAGAGG + Intergenic
1029224696 7:99016990-99017012 CAGTAAGCAAAACATTGTAGTGG - Intergenic
1037373030 8:18200574-18200596 TAATAAGCATAGTACTTGAGAGG - Intronic
1038619821 8:29131210-29131232 TAGTAAGCATAGTACTCAGGAGG - Intronic
1040885237 8:52255534-52255556 TAGTATGAAAAGTCTTGTAGAGG - Intronic
1041543947 8:59019251-59019273 TAGTAAACATAGTATTCTTCAGG + Intronic
1041800518 8:61792842-61792864 TAGTGAGCATAGTACTGGATAGG - Intergenic
1043113968 8:76224871-76224893 TAGGAAGCATGGAATTGCAGTGG - Intergenic
1043228438 8:77765795-77765817 TTGAAAGCATTGTATTGTACAGG + Intergenic
1043649312 8:82568825-82568847 TTTTAAGCAAAGTATTGGAGAGG + Intergenic
1043676197 8:82957493-82957515 TAGTAAGCATAGTATCTGATAGG - Intergenic
1046095255 8:109551129-109551151 TATTAAGCATGTTATTTTAGTGG - Intronic
1046408938 8:113813694-113813716 TAGTGAGCATAGTATTCAATAGG + Intergenic
1048856413 8:138690127-138690149 TAATAAGCATAGTAGCTTAGAGG - Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1056776537 9:89516939-89516961 TAATAAGCATAGTATAGGATAGG + Intergenic
1058095840 9:100859426-100859448 TAGTAAGCATAGTATCCCATAGG + Intergenic
1058861973 9:109125405-109125427 TAGACACCATATTATTGTAGAGG + Intergenic
1185925741 X:4143667-4143689 TAGTGAGCATAGTACTCAAGAGG - Intergenic
1186946742 X:14577176-14577198 TAGTAAGCAAATAATTGTGGTGG + Intronic
1187047831 X:15665366-15665388 TAATAAGCATAGTATTCGATAGG - Intergenic
1187047911 X:15666122-15666144 TAATAAGCATAGTATTCGATAGG - Intergenic
1187615354 X:20987818-20987840 TAGTGAGCATAGTACTTTACAGG - Intergenic
1191817326 X:65260456-65260478 TAATAAGCATAGTAATCTATAGG - Intergenic
1191934506 X:66411892-66411914 TACTAAGCATGCTATTGAAGAGG - Intergenic
1192276425 X:69636004-69636026 GAGTAAGCATAGAATTTTATAGG - Intronic
1192353325 X:70375763-70375785 TAGTAACCATTGTATTCTAAAGG - Intronic
1192708385 X:73552498-73552520 TAGTGAGCATAGTACAGTATAGG - Intergenic
1193427993 X:81363862-81363884 TATTAAGCATAGAATTAGAGAGG - Intergenic
1194144961 X:90250881-90250903 TATTAAACATAGTATTGGAAAGG + Intergenic
1194214752 X:91116024-91116046 TAATATGCATAGTACTGTATAGG - Intergenic
1194632929 X:96308543-96308565 TAGTAAACAGAGTATGGTACTGG + Intergenic
1194904906 X:99562837-99562859 TAATAAGCATAGTATTTGATAGG - Intergenic
1196540756 X:116904124-116904146 TAGTAAGCATAGTATCCAATAGG - Intergenic
1196665443 X:118311164-118311186 TAGAAAGCATAGAATTGCAAAGG + Intergenic
1198614268 X:138438213-138438235 TAGTAAAGATAGTATTGTAGTGG - Intergenic
1199098924 X:143775229-143775251 TAGTGAACATAGTATGGAAGAGG + Intergenic