ID: 1145119308

View in Genome Browser
Species Human (GRCh38)
Location 17:20242417-20242439
Sequence ATGGAGACACTGTCTGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145119303_1145119308 18 Left 1145119303 17:20242376-20242398 CCGACATTCAGTGAGGAGGGCCA 0: 1
1: 0
2: 2
3: 12
4: 137
Right 1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG 0: 1
1: 0
2: 1
3: 13
4: 192
1145119306_1145119308 -9 Left 1145119306 17:20242403-20242425 CCTTGCTGTGCTCCATGGAGACA 0: 1
1: 2
2: 1
3: 25
4: 264
Right 1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG 0: 1
1: 0
2: 1
3: 13
4: 192
1145119304_1145119308 -2 Left 1145119304 17:20242396-20242418 CCATGTGCCTTGCTGTGCTCCAT 0: 1
1: 0
2: 3
3: 25
4: 360
Right 1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145119308 Original CRISPR ATGGAGACACTGTCTGCTTA TGG Intronic
901147363 1:7074882-7074904 AAGGCAACACTGTCTGCTAAAGG - Intronic
902632434 1:17713134-17713156 GTGGAAAGACTGTCAGCTTAGGG - Intergenic
903747370 1:25596867-25596889 AGGGAGACTCTGGCTGCTGAGGG + Intergenic
904646383 1:31970286-31970308 ATGAGGACACTGTCTCCTGATGG + Intergenic
907746358 1:57217729-57217751 ATGGTGACACTGTCTCATTCAGG + Intronic
911262289 1:95701268-95701290 ATGGAGATAAACTCTGCTTAGGG + Intergenic
912754321 1:112311871-112311893 ATGGAGGCACTGTTTGGTTTTGG - Intergenic
914453960 1:147818062-147818084 AGGGAGAGCCTGTCTTCTTAGGG - Intergenic
915702210 1:157806796-157806818 AGGGAGACACTGTTTGCACAAGG - Intronic
915732260 1:158062045-158062067 ATGGAGAAACTTTCTCTTTAGGG - Intronic
922436064 1:225607813-225607835 CTGGAGACACTGACAGCTGAGGG + Intronic
1063263083 10:4412325-4412347 ATGGAGTCTCTGTATCCTTAAGG + Intergenic
1066007494 10:31158960-31158982 ATTAATACACTCTCTGCTTAGGG + Intergenic
1066567586 10:36736373-36736395 ATGTTGACTATGTCTGCTTATGG + Intergenic
1068918772 10:62461541-62461563 ATGGATACACTGTGTGCCAAAGG - Intronic
1070552868 10:77504543-77504565 ATAAAGAAACTGTCTGCTTGTGG - Intronic
1071236755 10:83657911-83657933 AGAGAGACACTCTCTGCTTAGGG - Intergenic
1071775801 10:88786518-88786540 AGGGAGTCACTGGCTGCTTACGG - Intergenic
1072315598 10:94199833-94199855 CTGGGGACACTGCCTGGTTAGGG - Intronic
1075427324 10:122352024-122352046 ATGGACAGACTGCCTGTTTAAGG + Intergenic
1079247475 11:18763293-18763315 ATGGAGCCACTGTCATCTTCTGG - Intronic
1082274374 11:50205925-50205947 ATGGTGCCAGTGTCTGCTTCTGG - Intergenic
1083115332 11:60453777-60453799 AAGGAGACAATGGCTGATTAAGG + Intronic
1083755025 11:64787754-64787776 AAGGAGGCACTGTCTGCTGCTGG + Intergenic
1086702938 11:89920760-89920782 CTAGAGAAACTGTCTGCTTGTGG + Intronic
1093607899 12:21116192-21116214 ATGGAGACACTGTATGACTTCGG + Intronic
1094896905 12:35050402-35050424 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1094947492 12:35869482-35869504 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1094951657 12:35937431-35937453 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1094958459 12:36047152-36047174 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1094960286 12:36076710-36076732 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1094967024 12:36185414-36185436 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1095005911 12:36814289-36814311 TTGGAGACACTGTCTTTGTAAGG + Intergenic
1097967294 12:65594947-65594969 AAGTAGAATCTGTCTGCTTATGG - Intergenic
1101497664 12:105270746-105270768 AAGGAGAGACTCTCTGCTTGAGG + Intronic
1101625227 12:106434163-106434185 ATGGAGACACTATATGTGTAAGG + Intronic
1103975378 12:124699371-124699393 TTGGAGATAGTGTGTGCTTAGGG + Intergenic
1105244000 13:18631526-18631548 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1112486491 13:99825074-99825096 ATGAAGTGACTGTCTGCTTATGG - Intronic
1112569581 13:100581601-100581623 ATGTAGACACTTTCCCCTTAAGG + Intronic
1113664704 13:112133186-112133208 AAGGAGACACTGTGAGCTTGAGG - Intergenic
1113919353 13:113898287-113898309 CTGGAAACACTGGCTGCCTAAGG - Intergenic
1114005233 14:18305842-18305864 ATGTTGACTATGTCTGCTTATGG + Intergenic
1114977234 14:28117096-28117118 AGAGAGACACTGTCTGCTTGGGG - Intergenic
1118301621 14:64621800-64621822 ATGGAGCCATTATCTGCTTCTGG - Intergenic
1121930174 14:97965000-97965022 ATGGAGCCACCTTCTGCTTTAGG + Intronic
1202840115 14_GL000009v2_random:114031-114053 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1202909498 14_GL000194v1_random:104228-104250 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1123389687 15:19858072-19858094 ATGTTGACTATGTCTGCTTATGG + Intergenic
1125712834 15:41800687-41800709 ATGGAGACAGTGGTTGCCTAGGG - Intronic
1126014990 15:44342186-44342208 ATGTAGAAAATGTCTGCATATGG - Intronic
1127034173 15:54896404-54896426 ATGGAGAATGTGTCTGCTTAGGG - Intergenic
1127470669 15:59287211-59287233 AGGGAGGCACTGTCTTCTAATGG + Intronic
1129068992 15:72935703-72935725 ATGCAGACACCCTCTGCTAATGG - Intergenic
1130302255 15:82689013-82689035 ATGGAGACAGTGTCTTCTCCTGG + Intronic
1130440070 15:83944557-83944579 AGGGAGACAACGTCTGCTTCTGG - Intronic
1130812429 15:87393948-87393970 ATGGTGCCACAGTCTGCTTCTGG + Intergenic
1132276105 15:100565523-100565545 ATGGAAAGACTGTCGACTTATGG + Intronic
1132484910 16:185817-185839 AGGGTGACGCTGTCTGCTTAAGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133404795 16:5514930-5514952 ATGGCGCCAGTGTCTGCTTTTGG + Intergenic
1133530205 16:6648242-6648264 GTAGAGACACTGTCTCCCTAAGG + Intronic
1136031367 16:27505690-27505712 ATGCAGACAATCTCTGCGTAGGG + Intronic
1139397235 16:66649929-66649951 TTGGAGACTCTCTGTGCTTAAGG + Intronic
1143701523 17:8664226-8664248 GTGGAGATACTGTCAGCTAAAGG - Intergenic
1143977064 17:10837753-10837775 CTGGAGGCACTGCCTGCTGAGGG - Intronic
1144387319 17:14760932-14760954 ATGGAGACAGTGTGGGCTAATGG - Intergenic
1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG + Intronic
1145201865 17:20952821-20952843 CTGGAGACACTGCCTGCCTGTGG + Intergenic
1145826107 17:27878300-27878322 AAGGAGACAACGTATGCTTAGGG + Exonic
1146277997 17:31527189-31527211 ATGGAGAAACAGTCTTCTTGTGG - Intronic
1149499515 17:57141350-57141372 AGGGAGCCACTCTCTGCTTATGG - Intergenic
1152281301 17:79386278-79386300 ATGGAGCCCCTGTCTGCTGTGGG - Intronic
1154444942 18:14428375-14428397 ATGGACAGACTGCCTCCTTAAGG - Intergenic
1154532196 18:15358017-15358039 ATGTTGACTATGTCTGCTTATGG - Intergenic
1156165088 18:34408829-34408851 ATGGAAAGACTGCCTTCTTAGGG - Intergenic
1157509604 18:48261300-48261322 ATGGAGCCCCTGTCTGCACACGG - Intronic
1157574045 18:48731979-48732001 ATGGAGCCGCTATCTGGTTATGG - Intronic
1159005387 18:63005652-63005674 AGGAAGACGCTGTCTGCTGAGGG - Intergenic
1159315964 18:66773399-66773421 ATGGAGATATTGTCTGCCTCTGG + Intergenic
1163489628 19:17609591-17609613 CTGGAGACTCTGTCTGGTGAAGG - Intronic
927030849 2:19119263-19119285 AAGCAGACACTGTATGCTTGGGG + Intergenic
927148214 2:20180572-20180594 ATGGACACACGGTTTACTTAGGG - Intergenic
928293439 2:30060582-30060604 ATGGAGAATCTGTGTGCTTGGGG + Intergenic
929136105 2:38625242-38625264 CTGGAGTCCCTGTCTGCTTCTGG - Intergenic
930180262 2:48349033-48349055 ATGGAGAGACTGTCTGCTCCTGG - Intronic
933708003 2:85305718-85305740 AAGGAGACAGTGTTTTCTTAAGG + Intronic
935616338 2:105086811-105086833 ATGGAGCCACAGTCTGCCTGTGG + Intronic
938531295 2:132189247-132189269 ATGTTGACTATGTCTGCTTATGG - Intronic
940559963 2:155282298-155282320 ATGGAGAATCTGTATGCTTGGGG - Intergenic
943663299 2:190582194-190582216 ATGGAGCCTCTATCAGCTTATGG - Intergenic
943774882 2:191754457-191754479 AAGGAGACATTATCTGCTGATGG - Intergenic
944059861 2:195561170-195561192 ATGGAGACACTGTAAGCTAAAGG + Intergenic
945391314 2:209268377-209268399 ATAGAGAATGTGTCTGCTTATGG - Intergenic
947063309 2:226191314-226191336 ATGAAGACACTGTATGCTGCTGG - Intergenic
1169117745 20:3076806-3076828 AAAGAGACACTGTGGGCTTAAGG + Intergenic
1169655567 20:7918928-7918950 AATGAGACAGTGTCTGCTTTGGG - Intronic
1172608244 20:36230200-36230222 AAGTAGACATTGTATGCTTATGG + Exonic
1173997907 20:47353583-47353605 ATGGATTCACTTTCTGCTTTGGG - Intronic
1174918211 20:54675520-54675542 AGGGAAACACTGTGTGCTCATGG + Intergenic
1175635857 20:60582501-60582523 ATGCTGTCACTGTCTCCTTACGG + Intergenic
1176089861 20:63313948-63313970 ATGGCCACACTGTCTGCGAAGGG + Intronic
1176451043 21:6861497-6861519 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1176628849 21:9118936-9118958 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1176765168 21:13010178-13010200 ATGTTGACTATGTCTGCTTATGG + Intergenic
1176829212 21:13726548-13726570 ATGGACAGACTGCCTCCTTAAGG + Intergenic
1177541050 21:22494150-22494172 AGGGACAGACTGTCTCCTTAAGG + Intergenic
1178692599 21:34761825-34761847 ATGGAGACAAGGTCTGCAGAAGG - Intergenic
1180378290 22:12114507-12114529 ACGGAGACACTGGCTGCTGTGGG - Intergenic
1180419223 22:12798772-12798794 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1180429744 22:15236634-15236656 ATGTTGACTATGTCTGCTTATGG + Intergenic
1180512354 22:16104973-16104995 ATGTTGACTATGTCTGCTTATGG + Intergenic
1180671079 22:17553589-17553611 ATGGAGACACCAGGTGCTTAGGG - Exonic
1180755296 22:18156912-18156934 AGAGAGACACTGTTTGCTTGGGG - Intronic
1185298596 22:50067287-50067309 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298601 22:50067310-50067332 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298678 22:50067633-50067655 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298683 22:50067656-50067678 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298696 22:50067702-50067724 ATGGAGTCACTGTCTGATGGAGG - Intronic
1185298705 22:50067773-50067795 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298710 22:50067796-50067818 ATGGAGTCACTGTCTGATGGGGG - Intronic
1185298715 22:50067819-50067841 ATGGAGTCACTGTCTGATGGGGG - Intronic
949253723 3:2019758-2019780 ATGGTGCCAGTGTCTGCTTCAGG - Intergenic
952499782 3:33950088-33950110 AGGGAGAGACTGTTGGCTTAAGG + Intergenic
953588000 3:44222487-44222509 ATGGAGCAACTGGCTGCTTGAGG - Intergenic
956688986 3:71858705-71858727 AAGGAGAGACAGTCTGCTCAGGG + Intergenic
957810458 3:85215012-85215034 AGGGAGACTCCTTCTGCTTAGGG - Intronic
961536056 3:127571689-127571711 ATGGAGACCCTGGGTGCTTCAGG + Intergenic
963061420 3:141230199-141230221 ATGAAGAGCCTGTCTGCTTCAGG - Intronic
964122770 3:153203608-153203630 AGGGAAACACTGTCTCCCTAGGG + Intergenic
966910776 3:184558763-184558785 CTGGAAACACTGTCTGTTTGGGG - Intronic
971895114 4:32582112-32582134 TTGGAGACACTGTCTTCTGGTGG + Intergenic
973019959 4:45190740-45190762 ATGGAGACTCTGATTGCTAAAGG + Intergenic
973806115 4:54527677-54527699 ATGGAGTGCCTGTCTGCTCAGGG + Intergenic
984343645 4:178491072-178491094 AGAGAGACACTGTCTTCTTGGGG + Intergenic
984596716 4:181677271-181677293 ATGGAGACACTCAGTGCCTATGG - Intergenic
1202759911 4_GL000008v2_random:99973-99995 ACGGAGACACTGGCTGCTGTGGG - Intergenic
988323961 5:29737921-29737943 CTGGAGGCACTGACTGCATAAGG - Intergenic
988935824 5:36082036-36082058 ATGGACACACAGTATGTTTAAGG - Intergenic
989250107 5:39303713-39303735 CTGGGGTCACTGTCTGCATAGGG + Intronic
990834157 5:59996496-59996518 ATGGAGAAAATGTCTGCTATTGG - Intronic
994745034 5:103667441-103667463 AGGGAGTCATTCTCTGCTTATGG - Intergenic
995848579 5:116520805-116520827 ATGGAGAACCTGACTGCCTATGG + Intronic
997374869 5:133390703-133390725 CTGAAGACACTCTCTGCTGATGG + Intronic
998689387 5:144570634-144570656 AGAGAGACACCTTCTGCTTAAGG - Intergenic
1000396831 5:160784605-160784627 TTGGAGAAACAGTCTGCATATGG + Intronic
1000974042 5:167745367-167745389 ATGGAGACACTGGCTTCTTTGGG - Intronic
1001928861 5:175658592-175658614 ATGGAGCAACTTTCTGCTAAAGG + Intronic
1007177259 6:39905491-39905513 ATGAAGACACTGTGTGGGTAGGG - Exonic
1007372480 6:41435339-41435361 ATGGAGACACTTTGTCCTCATGG - Intergenic
1009445166 6:63733832-63733854 ATGGAGATACTGTCTTCATTTGG - Intronic
1012070457 6:94607229-94607251 ATGGAGACCCTGTCTGCCCCAGG + Intergenic
1013770444 6:113622372-113622394 AAGGGGACAGTGTCTGCTTTAGG - Intergenic
1013794607 6:113873072-113873094 AGGGACAAACTCTCTGCTTATGG - Intergenic
1014865707 6:126527039-126527061 GTGTAGACACTGTCTGCCTGTGG + Intergenic
1015841585 6:137482811-137482833 ATGGAGACAGTGTCTCCCTCTGG + Intergenic
1018598833 6:165516241-165516263 ATTAAGAGACTGTATGCTTATGG - Intronic
1018850116 6:167581613-167581635 ATGGAGAGACTGTCTGCTCAGGG + Intergenic
1019901296 7:4022589-4022611 ATGGAGAAGCTGTCTGCTGCAGG + Intronic
1020659665 7:10966863-10966885 ATGAAAACACTGTCTCCTTCAGG + Intergenic
1023469951 7:40506927-40506949 ATGTTGACACTGTCTCCTAAAGG - Intronic
1023596204 7:41831555-41831577 GTGGAGACATTGCCTGCTGACGG - Intergenic
1025194751 7:56924062-56924084 AGGGAGACACTGTGTGCATCAGG - Intergenic
1025215403 7:57051780-57051802 ATGGTGCCAGTGTCTGCTTCTGG - Intergenic
1025626148 7:63224206-63224228 ATGGTGCCAGTGTCTGCTTCTGG - Intergenic
1025655971 7:63518923-63518945 ATGGTGCCAGTGTCTGCTTCTGG + Intergenic
1025677201 7:63652881-63652903 AGGGAGACACTGTGTGCATCAGG + Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1032265507 7:130367569-130367591 TTGGTGAGACTGGCTGCTTAGGG + Exonic
1032981372 7:137287393-137287415 ATGGAGTTCCTTTCTGCTTAGGG + Intronic
1034587732 7:152110557-152110579 ATGGAAATACTGTCTGTTCATGG - Exonic
1035868594 8:3112098-3112120 ATGCAGACCCTGTCTGCTAGAGG - Intronic
1039310476 8:36313241-36313263 ATGCAGACACTGACTACTTGCGG - Intergenic
1039800299 8:40948879-40948901 ATTGAGACATAGTCTGCTCAAGG - Intergenic
1041615907 8:59906845-59906867 ATGGAGAATCTGTGTGCTTAGGG + Intergenic
1041852356 8:62405589-62405611 ATGGAGAATCTATGTGCTTAGGG - Intronic
1042039007 8:64572341-64572363 ATGGAGACACTGTATGTCAAAGG - Intergenic
1042566210 8:70114685-70114707 GTGGAAATACTGTCTGCTTTGGG + Intronic
1044854780 8:96464142-96464164 TTGGAGACACTCTCATCTTATGG - Intergenic
1045171608 8:99676534-99676556 AGAGAGACACCGTCTGCTTGGGG - Intronic
1045479698 8:102582126-102582148 TTGGTGACTCTGTCTTCTTAGGG + Intergenic
1045692213 8:104771634-104771656 AAGGAGACACTATATTCTTAAGG - Intronic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1047930802 8:129726784-129726806 ATGGAGACTCTGACTGCTAGAGG - Intergenic
1048125443 8:131629925-131629947 ATAGTGACACTAACTGCTTAAGG + Intergenic
1048151574 8:131900337-131900359 ATGGTGCCAGTGTCTGCTTCTGG + Intergenic
1049777202 8:144412240-144412262 ATGGAGACCCTGCCTGCCTGAGG - Intronic
1050956840 9:11673072-11673094 ATGGCAACAGTGTCTGCTTCTGG - Intergenic
1053709903 9:40795745-40795767 ATGTTGACTATGTCTGCTTATGG - Intergenic
1054419807 9:64916539-64916561 ATGTTGACTATGTCTGCTTATGG - Intergenic
1056011082 9:82331324-82331346 CTGGAGACATTTTCTTCTTATGG + Intergenic
1060051317 9:120380272-120380294 CAGGAGACAGTGTCTGCTGAAGG + Intergenic
1203518138 Un_GL000213v1:23020-23042 ATGGACAGACTGCCTCCTTAAGG - Intergenic
1203751697 Un_GL000218v1:86617-86639 ATGGAGACACTGGCTGCAGTGGG + Intergenic
1203540684 Un_KI270743v1:84867-84889 ACGGAGACACTGGCTGCTGTGGG - Intergenic
1186632314 X:11363172-11363194 ATGGAGCCACAGTATGCTAAGGG + Intronic
1186746190 X:12572026-12572048 TTGGAGAAACTGTCTTTTTAAGG - Intronic
1188228546 X:27632106-27632128 AGGGAGAAACTTTCTGCTTGAGG - Intronic
1190180972 X:48191967-48191989 ATAGAAACAATGTCTTCTTAAGG + Intronic
1190199889 X:48351834-48351856 ATAGAAACAATGTCTTCTTAAGG + Intronic
1190666669 X:52702315-52702337 ATAGAAACAATGTCTTCTTAAGG + Intronic
1190672749 X:52756093-52756115 ATAGAAACAATGTCTTCTTAAGG - Intronic
1192788002 X:74353825-74353847 ATGGAGATACCCTCTGCTTGGGG + Intergenic
1194652998 X:96537932-96537954 AAGGAGACACCTTCTGCTTATGG + Intergenic
1197723941 X:129763151-129763173 ATGGAGAAACTCTCTACTAAGGG + Intronic
1199978513 X:152908179-152908201 ATGGGGACAGTGTTTGCTTTTGG + Intergenic
1201165354 Y:11204237-11204259 ATGGAGACACTGGCTGCAGTGGG + Intergenic