ID: 1145122976

View in Genome Browser
Species Human (GRCh38)
Location 17:20277326-20277348
Sequence GTAAGCCATCTTACCCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145122976_1145122977 -7 Left 1145122976 17:20277326-20277348 CCTAATTGGGTAAGATGGCTTAC 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1145122977 17:20277342-20277364 GGCTTACCAATTTGCTAAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1145122976_1145122978 -6 Left 1145122976 17:20277326-20277348 CCTAATTGGGTAAGATGGCTTAC 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1145122978 17:20277343-20277365 GCTTACCAATTTGCTAAGTAGGG 0: 1
1: 0
2: 1
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145122976 Original CRISPR GTAAGCCATCTTACCCAATT AGG (reversed) Intronic
904906513 1:33901129-33901151 GAATGCCATCTTGCCCCATTGGG - Intronic
909833872 1:80229805-80229827 GTATGCCATGTTATTCAATTTGG - Intergenic
910274297 1:85431672-85431694 GTAATGCATCTGACCCTATTAGG + Intronic
912477143 1:109946016-109946038 GAATGCCATCTTACCCAGGTGGG - Intergenic
917931894 1:179828381-179828403 CAAAGCCAACTTACCCAATATGG + Intergenic
924799945 1:247321931-247321953 GTTAGCCAGGTTACCCAGTTAGG - Intronic
924800417 1:247325890-247325912 GTTAGCCAGGTTACCCAGTTAGG - Intronic
1065198947 10:23295395-23295417 GGGAGCTGTCTTACCCAATTGGG + Intronic
1065786879 10:29224108-29224130 GGAAGCCACTTTACCTAATTAGG + Intergenic
1066024092 10:31335434-31335456 GTAACCCATCATAACCAAGTTGG + Intronic
1072479733 10:95799104-95799126 GTAAGGCATAATACCCATTTAGG + Intronic
1079145967 11:17852187-17852209 GCAAGTCATCTTACCTAACTGGG - Intronic
1080469098 11:32527892-32527914 TTCAGCCAGCTTACCCACTTAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092334181 12:7614484-7614506 GTAAACCATTTTACCCATTGTGG + Intergenic
1094567413 12:31612279-31612301 GTGAGCCACCTTACCCAGCTTGG - Intergenic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1099078177 12:78138815-78138837 AAAAGCCATCTTGCCCACTTAGG - Intronic
1099194086 12:79594509-79594531 GTAAGATATTTTACCAAATTGGG - Intronic
1126959469 15:53975252-53975274 ATAAACCATCTTATGCAATTTGG - Intergenic
1128420919 15:67490994-67491016 TTAAGTCATCCTACCTAATTGGG + Intronic
1136663652 16:31789316-31789338 GTAAGCCATCATACCCGGCTGGG - Intronic
1137725137 16:50651799-50651821 CTAAGGCATTTGACCCAATTAGG + Intergenic
1144511481 17:15880876-15880898 GTAAGCAATCTTGCCCAATTAGG - Intergenic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1150711421 17:67533708-67533730 GGAAGCCATCTTAACCACTTTGG - Intronic
1153060901 18:994249-994271 GTAAGTTATCTGAACCAATTTGG - Intergenic
1160464371 18:79063867-79063889 GTAAGCCACCGCACCCAGTTGGG + Intergenic
1168391723 19:56014197-56014219 GTAAGCCACCGTACCCAGCTGGG - Intronic
941091957 2:161187141-161187163 GTGAGCCACCATACCCAGTTTGG - Intronic
941734403 2:168956942-168956964 CTAAGGCAGCTTACCCAGTTGGG - Intronic
943250949 2:185520835-185520857 GAAAGCCAAGTTACCCCATTAGG - Intergenic
945410506 2:209500759-209500781 ATAAGCCACCATACCCAACTGGG - Intronic
1169171184 20:3467094-3467116 GTAAGGCATCTTACTCACCTTGG - Intergenic
1170692949 20:18631469-18631491 GTCATCCATCTTATCCCATTGGG + Intronic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1173131492 20:40398225-40398247 GTAAGCCATTTTGCTCAGTTGGG - Intergenic
1178538488 21:33429800-33429822 GTAAGCCACCTTACCAGTTTGGG + Intronic
1178955955 21:37022055-37022077 GTAAGCCACCATGCCCAACTTGG - Intergenic
953585567 3:44198117-44198139 GTAAGTAATCTTATTCAATTAGG - Intergenic
954336413 3:49920873-49920895 GTAAGCCACCATACCCAGCTAGG - Intronic
955581840 3:60431654-60431676 CAAAGCCATCTTACCAAAGTCGG + Intronic
957221660 3:77390310-77390332 GTATGGCATCTTACACAGTTTGG + Intronic
961904502 3:130248588-130248610 GTAAGTAATCTTTCCCAATGTGG + Intergenic
962127422 3:132635381-132635403 GTAACTCATATTACCCAAATGGG - Intronic
965470846 3:169088871-169088893 GAAAGGCATCTGACCCCATTTGG + Intronic
966039731 3:175467303-175467325 ATAAGCCATCTCAGCAAATTAGG - Intronic
969599701 4:8168980-8169002 GAAAGGCATATGACCCAATTCGG + Intergenic
970689632 4:18607637-18607659 GTAAACCATCATACAAAATTTGG - Intergenic
976376967 4:84356683-84356705 ATCAGCTAGCTTACCCAATTTGG + Intergenic
981206865 4:142052619-142052641 GTAAGCCTTTTTTCCCATTTGGG + Intronic
984381084 4:178994298-178994320 GTATGCCATCTTGCCATATTTGG + Intergenic
989707290 5:44351021-44351043 GTAAGCAGTCTTACCCAAGAAGG - Intronic
996619192 5:125479547-125479569 ATATCCCATCTCACCCAATTGGG + Intergenic
999256990 5:150215209-150215231 TTAAGCCACCTTACCCAGCTGGG + Intronic
1002693181 5:181065239-181065261 GTAAGGCATCATACCAAAGTAGG + Intergenic
1005307194 6:24525264-24525286 GTAAGCCATCCTAGCCGATGGGG + Intronic
1005660628 6:27995529-27995551 ATAAGTCATCTTAGCCAGTTTGG + Intergenic
1013461527 6:110378983-110379005 CTAACCCATCTTTCCTAATTGGG + Intergenic
1014727553 6:124990780-124990802 GTAAGCCACCATGCCCAATTTGG - Intronic
1021242380 7:18219511-18219533 GTAAGCCATCTGCCAAAATTTGG + Intronic
1028674830 7:93447007-93447029 GAAAGCCATATTATCCACTTTGG + Intronic
1032564070 7:132922641-132922663 GTAAGTCATATTTCCCACTTGGG + Intronic
1038977844 8:32721079-32721101 GAAAGGAATCTTACCCACTTAGG + Intronic
1053252894 9:36589849-36589871 GTAAACCATACTACCCCATTAGG - Intronic
1185847645 X:3453902-3453924 GTATGCCTTCTAACCCAATCTGG - Intergenic
1201536618 Y:15055847-15055869 GTAAGCCACCATACCCAGTCAGG - Intergenic