ID: 1145124235

View in Genome Browser
Species Human (GRCh38)
Location 17:20286957-20286979
Sequence CAGGAGCCAGGACTTTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145124235_1145124246 12 Left 1145124235 17:20286957-20286979 CCCCAAGAAAGTCCTGGCTCCTG 0: 1
1: 0
2: 2
3: 26
4: 260
Right 1145124246 17:20286992-20287014 CCTTGCACTCCTTAGGCCATCGG 0: 1
1: 0
2: 1
3: 4
4: 137
1145124235_1145124242 5 Left 1145124235 17:20286957-20286979 CCCCAAGAAAGTCCTGGCTCCTG 0: 1
1: 0
2: 2
3: 26
4: 260
Right 1145124242 17:20286985-20287007 CTGATCCCCTTGCACTCCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145124235 Original CRISPR CAGGAGCCAGGACTTTCTTG GGG (reversed) Intronic
900154960 1:1200237-1200259 CAGGACCCAGGACTCACCTGTGG - Intergenic
900657168 1:3764122-3764144 CAGGGGCCAGGAGATGCTTGAGG - Intronic
900862642 1:5244265-5244287 CAGAAGCCAGGATTTCCGTGAGG + Intergenic
901049873 1:6420673-6420695 CATGAGCCCTGACTGTCTTGCGG - Intronic
902124206 1:14194794-14194816 CATGAGCCACCACTTTCTAGAGG + Intergenic
902364354 1:15961760-15961782 CAGGAGCCAGGTCACACTTGGGG - Intronic
902518128 1:17000645-17000667 CTGGAGCCAGGCCTTTCTCCTGG + Intronic
903932681 1:26872556-26872578 CAGGAGCCAGGAATGTCTGTGGG + Intergenic
905251101 1:36648986-36649008 CAGGATCCAGGACATGCATGGGG - Intergenic
906025216 1:42667777-42667799 CTGGAGCCAGGTCTTTCTAGGGG - Intronic
907245880 1:53108842-53108864 CACGAGTCAGGACTTGCTTTTGG - Intronic
912501978 1:110128823-110128845 CATGAGCCAGGGCCTTCTTCTGG + Intergenic
914346647 1:146805713-146805735 CAGGAGAAAGTCCTTTCTTGAGG + Intergenic
915921463 1:159978765-159978787 CTGGAACAAGGACTTTCTGGTGG - Intergenic
917447410 1:175118378-175118400 GAGGAGCCAGGTATATCTTGGGG + Intronic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
920365691 1:205447264-205447286 CAGTAGACAGGACTGTCTTGAGG + Intronic
920530421 1:206697883-206697905 CAGGTCCTAGGACTTGCTTGGGG - Intronic
920608412 1:207412992-207413014 GAGGTGGCAGGACTTTCCTGGGG + Intergenic
922227252 1:223656099-223656121 CAGGAGCCAGCACCTTATAGAGG - Intronic
923149007 1:231217524-231217546 GAGGAGCCACCACTTTCCTGGGG + Intronic
1064540831 10:16403448-16403470 TAGGAGCCAGGACTTGCCTCAGG - Intergenic
1064598926 10:16973651-16973673 CAGGCGCCAGGGCCTACTTGAGG - Intronic
1064640888 10:17414944-17414966 CAGGAGCCAGAACATACTGGGGG - Intronic
1064791081 10:18958682-18958704 CAGGAGGCAGGACTCTCTGCAGG - Intergenic
1065756995 10:28939840-28939862 CAGGAGCCAGGACTCTCACACGG - Intergenic
1067338525 10:45382828-45382850 CAGGAGGCATGACTTTCCTTGGG + Intronic
1067535660 10:47107949-47107971 CAGGAGGAGGGACTTCCTTGAGG - Intergenic
1070501919 10:77080473-77080495 CAGCAGCCAGGGCTATCCTGAGG + Intronic
1070557455 10:77539571-77539593 CAGGGGCCAGGAATTTGGTGGGG - Intronic
1072532090 10:96329419-96329441 CAGGAGTCAGGGCTTGCATGTGG - Intronic
1074566344 10:114581762-114581784 CAGGTCCCAGAACTTTCATGGGG - Intronic
1074829815 10:117240799-117240821 CACGGACCAGGGCTTTCTTGTGG - Intergenic
1075513320 10:123089637-123089659 GAGGTCCCATGACTTTCTTGTGG + Intergenic
1075565583 10:123501572-123501594 CAGGAGCCAGCACTAACTTTGGG - Intergenic
1077469511 11:2750418-2750440 CAGGAGCCTGGACATTCTGCTGG - Intronic
1078328431 11:10398828-10398850 CAGGAGACTGGACTTCCTGGGGG + Intronic
1078860410 11:15241263-15241285 CAAGAGCCAGCACTTTCTTCTGG - Intronic
1081762331 11:45585037-45585059 CACCAGCCAGGCTTTTCTTGAGG + Intergenic
1081853539 11:46290223-46290245 CAGGAGCCAGGACATGGTTCAGG - Intronic
1082041620 11:47690298-47690320 CAGGAGCCATTACTTTCTCCAGG + Exonic
1082611841 11:55308982-55309004 CAGGAGCTAGGGCTTCCCTGGGG + Intergenic
1082716219 11:56617422-56617444 CAGGCACCAGGACCTACTTGAGG - Intergenic
1084361220 11:68669737-68669759 CAGGAGCCGGGGCTTTCTCTGGG + Intergenic
1084891103 11:72237555-72237577 CACCAGCCAGCACTTTCCTGGGG + Exonic
1085415023 11:76313981-76314003 CATCAGCCAGGACTTGCTGGGGG - Intergenic
1085859311 11:80213596-80213618 AAGGAGGCTGGACTTTCTTAAGG - Intergenic
1087128316 11:94647427-94647449 AATGAGCCAGGACTTGCGTGAGG - Intergenic
1087144735 11:94800172-94800194 CAGGAGCACGGACTTTTTTATGG + Exonic
1087221353 11:95549800-95549822 CAGAAGACAGGACATGCTTGTGG - Intergenic
1087227103 11:95613747-95613769 CATGAGGCAGTACTTTCTTTTGG - Intergenic
1088627215 11:111737856-111737878 AAGGAGCCAGGTCTTTCCTGTGG - Intronic
1090022582 11:123140894-123140916 GAGGAGCCAAGACATTCATGAGG - Intronic
1090399880 11:126442376-126442398 CAGGAGCTAGGAATTCCCTGAGG + Intronic
1091433694 12:457478-457500 AAGAGGCCAGGACATTCTTGTGG - Intergenic
1091719832 12:2804575-2804597 CTGGAGCCAGGATTATCTGGAGG - Exonic
1092019818 12:5192099-5192121 CAGCAGCCATGACATTCTGGGGG - Intergenic
1092754943 12:11754393-11754415 CAGGAGCGAGGGCCTCCTTGGGG - Intronic
1093227506 12:16503591-16503613 CAGGAGGCAGGACTTAATTCTGG + Intronic
1093379953 12:18480071-18480093 CTGGAGCCAAGGCTTTCTTGGGG + Intronic
1095347465 12:41168459-41168481 CAGGCTCCAGCACGTTCTTGTGG - Intergenic
1096178991 12:49540313-49540335 CAGGAGCCAGGAATGTATTGGGG - Intronic
1096555700 12:52402370-52402392 CAGAAGCAATGCCTTTCTTGAGG - Intronic
1097030520 12:56086333-56086355 GAGGAGGCAGGAGTTTCTTTTGG + Intronic
1101291799 12:103377765-103377787 CAGGACCCAGGTTTTTCTGGGGG + Intronic
1102010890 12:109617756-109617778 CAGGGGCCAGAGCTGTCTTGTGG - Intergenic
1102829684 12:115986287-115986309 AAGGAGCCAAAACTTTCTTCAGG - Exonic
1104470005 12:129022256-129022278 CAGGAGCCAAGCCTTTCTTGGGG + Intergenic
1104481930 12:129115252-129115274 CAGGAGCCAGATCATGCTTGTGG - Intronic
1105330272 13:19409602-19409624 AAGTTGCCAGGACTTTCTTCTGG - Intergenic
1106378391 13:29211940-29211962 CAGGAGGCAGGACTAACTTGAGG - Intronic
1106392388 13:29347155-29347177 CAGGAGGCAGGACTAACTTGAGG - Intronic
1108079770 13:46723064-46723086 CTTGAGCCAGGCTTTTCTTGTGG + Intronic
1110287736 13:73769411-73769433 CAGCAGCCAAGACATTCTTCTGG + Intronic
1112567626 13:100564852-100564874 CAGAAGCCAGGCCTTTATGGGGG + Intronic
1112576402 13:100640301-100640323 CAGCAGACAGTTCTTTCTTGTGG - Intronic
1112610725 13:100952323-100952345 GACAAGCCAGGACTTTCTTGTGG + Intergenic
1112852825 13:103727941-103727963 CTGAAGCAAGGACTTTCTTCTGG - Intergenic
1116121376 14:40725161-40725183 CAGGTGCCAGGGCTGTCTTGGGG - Intergenic
1116399759 14:44492104-44492126 CAAAAGCCAGGCCTTTCTTTGGG - Intergenic
1117548599 14:56812217-56812239 CAGGAGTCAAGAGTTTCTAGGGG + Intergenic
1119974858 14:79014267-79014289 CAGGAACTATGGCTTTCTTGAGG - Intronic
1121253924 14:92517940-92517962 CAGAGGGCAGGACTTTCTTGAGG - Intronic
1122270179 14:100565503-100565525 CTGGAGCCAGGACTGACTTATGG - Intronic
1122400055 14:101461706-101461728 CAGGGGCCAGGAAATTCTAGAGG - Intergenic
1122400138 14:101462119-101462141 CAGGAGCCAGGACCTGCTGGAGG - Intergenic
1123030405 14:105448773-105448795 GAGGAGCCAGGACTTCCTGCAGG + Intronic
1202893671 14_KI270722v1_random:183320-183342 CAGGAGCCGGGATTCTCTGGCGG - Intergenic
1124382296 15:29177015-29177037 CAGGGCCCAGGACTTTCAAGAGG + Intronic
1124800857 15:32831519-32831541 CAGGAGCCAGGGCTTTGCAGAGG + Intronic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1127286698 15:57539351-57539373 CAGGATCCAGCCCTGTCTTGGGG - Intronic
1127760142 15:62131667-62131689 CAGAAGCCTGGACTCACTTGTGG + Intergenic
1128303293 15:66580899-66580921 CAGAAGCCAGGACTGTCCTGTGG + Intergenic
1128805332 15:70526624-70526646 CAGGAGCCACGTCTTTGCTGGGG + Intergenic
1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG + Intronic
1130415761 15:83693347-83693369 CAGGAGGCAGGAGGTGCTTGGGG + Intronic
1132335215 15:101044078-101044100 CAGGAGCGGGGACTTGCCTGGGG - Intronic
1133886264 16:9830858-9830880 CAAGAGGCAGGAAATTCTTGGGG + Intronic
1135543856 16:23352855-23352877 CAGGAGCCAGGATTCTCTCCAGG - Exonic
1139634877 16:68252344-68252366 CAGGAACCTGGAGTTTCTGGTGG - Intronic
1139987334 16:70909557-70909579 CAGGAGAAAGTCCTTTCTTGAGG - Intronic
1141144476 16:81519399-81519421 AAGGGGTCAGGACTTTCTTTGGG - Intronic
1141832228 16:86516144-86516166 CTGGAGCCAGGATCTCCTTGCGG - Intergenic
1143396212 17:6599961-6599983 CACAATCCAGTACTTTCTTGAGG - Intronic
1144616989 17:16785550-16785572 CAGAAGCCCTGACTTTCTTTAGG + Intronic
1144811651 17:18004019-18004041 AAGGAGCCATGGCTTTCATGGGG - Intronic
1144895702 17:18530124-18530146 CAGAAGCCCTGACTTTCTTTAGG - Intergenic
1145124235 17:20286957-20286979 CAGGAGCCAGGACTTTCTTGGGG - Intronic
1145136515 17:20414108-20414130 CAGAAGCCCTGACTTTCTTTAGG + Intergenic
1146891233 17:36507763-36507785 CAGGAGGCAGGTCCTTCTTTTGG - Intronic
1147007320 17:37413961-37413983 CAGAAACCAGGGCCTTCTTGAGG - Intronic
1147961138 17:44168350-44168372 CAGGAGCTAGAACTTGCTTATGG + Intergenic
1148149331 17:45387014-45387036 CAGGACCCAGGACTATCCTTGGG + Intergenic
1148197956 17:45728473-45728495 CACTAGCCTGGGCTTTCTTGTGG - Intergenic
1151124470 17:71830004-71830026 CAGTATCCAGGTCTTTCATGAGG + Intergenic
1152661166 17:81542850-81542872 CAGGGGATGGGACTTTCTTGGGG + Intronic
1153976589 18:10273460-10273482 CAGGAGGCAGAACATGCTTGGGG + Intergenic
1155295428 18:24380532-24380554 CTGGATCCAGGAATTTGTTGGGG - Intronic
1155317429 18:24586468-24586490 AAGGATCCTGGACTTTCTGGAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156621584 18:38857810-38857832 GAGGAGCCTGGACTTTCATTTGG + Intergenic
1156918989 18:42496023-42496045 AAGGAGCTAGGACTTGGTTGAGG - Intergenic
1157555495 18:48610516-48610538 CAGGAGCCAGGAATCTAATGAGG + Intronic
1161135162 19:2615301-2615323 CAGGAGGAAGGACATTCTGGAGG - Intronic
1162105836 19:8369140-8369162 CAGGAGCCAGGCATATCTGGGGG - Intronic
1163270971 19:16253760-16253782 CTGGAGCCAGGACCTTCACGTGG + Intergenic
1163694151 19:18754656-18754678 CAGGAGTAAGGAATTTGTTGAGG + Intronic
1163861149 19:19743529-19743551 CATGAGCCAGGACTATCTCAGGG + Intergenic
1164862769 19:31575693-31575715 CAGGAGGCAGGAGTATTTTGTGG + Intergenic
1164929655 19:32165718-32165740 GAGGGGCCAGGATGTTCTTGGGG - Intergenic
1165181506 19:33975458-33975480 AAGGGGCCAGGAGTATCTTGGGG - Intergenic
1165460925 19:35943955-35943977 CAGGAGGCTGGACTGCCTTGAGG + Intronic
1165618088 19:37219645-37219667 GAGATGCCAGGCCTTTCTTGTGG - Intronic
1167095511 19:47373173-47373195 AAGGAGCCTGGACTTTCTCCAGG - Intronic
925225459 2:2180225-2180247 AAGGAGCCATGAGTTCCTTGGGG - Intronic
928402764 2:30991251-30991273 CAGAGGCCAGGGCTTTCTTGAGG - Intronic
928648931 2:33384684-33384706 TAGCAGCCAAGAGTTTCTTGTGG + Intronic
929548851 2:42876171-42876193 CAGGACTCAGGACTTCCTTCTGG + Intergenic
930873562 2:56190298-56190320 AAGGAGCCAGCAGTTCCTTGAGG - Intronic
932436514 2:71705198-71705220 CAAGAGCCAGGTCTCTCTCGGGG + Intergenic
935150286 2:100427774-100427796 CAGGAGCCTGGCCTGTCTCGCGG - Intergenic
938764624 2:134452220-134452242 CAGAATCCAGCCCTTTCTTGAGG - Exonic
941452308 2:165674205-165674227 GAGGAGTCAGGACTTTGCTGAGG + Intronic
945043676 2:205763671-205763693 CAGATGACAGGAATTTCTTGCGG + Exonic
945116880 2:206416695-206416717 CAGGAGCCAGAAGCTTGTTGGGG - Intergenic
946052630 2:216876881-216876903 GAGGAGCCAGGGTTTACTTGGGG - Intergenic
948479908 2:238242812-238242834 CAGAAGCCTGGCCTATCTTGAGG + Intergenic
948938214 2:241182159-241182181 CAGCAGCTGGGACTTCCTTGTGG + Intronic
1168983179 20:2025091-2025113 CAGCAGGGAAGACTTTCTTGAGG - Intergenic
1170014426 20:11765018-11765040 GAGGAACCAGGAAATTCTTGTGG + Intergenic
1173562396 20:44015210-44015232 CAGGGGCCAGGAGTTTCATCTGG - Intronic
1173615390 20:44400209-44400231 CAGGAACCAGGACTTTCTAAGGG + Intronic
1175550502 20:59814252-59814274 CAGGAGCCAGCACCATCCTGGGG + Intronic
1175679684 20:60976898-60976920 CAGCAGCCAGGGATTTCCTGTGG + Intergenic
1176025919 20:62985613-62985635 CCGGGGCCAGGACTCCCTTGAGG - Intergenic
1176299122 21:5090326-5090348 CAGGAGCCAGGGCTGTCTGCAGG + Intergenic
1178684956 21:34703401-34703423 GAGCAGCCAGGAATGTCTTGGGG + Intronic
1179494476 21:41763114-41763136 CAGGACCCAGGACACTTTTGCGG - Intronic
1179505577 21:41837862-41837884 CAGCAGCCAGGCCATTCTGGAGG - Intronic
1179857904 21:44171622-44171644 CAGGAGCCAGGGCTGTCTGCAGG - Intergenic
1180564618 22:16652225-16652247 AAGTTGCCAGGACTTTCTTCTGG + Intergenic
1181622593 22:24101155-24101177 CAGGCGTCAGGACTTTCCTTGGG + Intronic
1181694859 22:24587973-24587995 CAGGAGGCAGGACCGTCCTGTGG + Intronic
1182253777 22:29023332-29023354 AAGGAGGCATGACTTTCCTGAGG - Intronic
1182597739 22:31435187-31435209 CTGAAGCCAGGACTTTCATGGGG - Intronic
949201398 3:1384001-1384023 GAGGAGGCAGGACTTTACTGTGG - Intronic
949827949 3:8182941-8182963 CTGGAGCCAGAACTTTCTGTAGG - Intergenic
950215492 3:11155434-11155456 CAGGAGACGTGACTTCCTTGAGG - Intronic
952453074 3:33449439-33449461 CAGGACCCAGGGCTTGCTTTTGG - Intergenic
952688429 3:36175859-36175881 CAGAAGCAAGGAGTTTCTTTTGG + Intergenic
954119290 3:48486086-48486108 TTGGAGCCAGGACTTTCTCCAGG - Intronic
954338923 3:49937977-49937999 CAGGAGCCAGGGCCTTCTGTGGG + Intergenic
954677650 3:52324577-52324599 AAGGAGCCAGGTCTTTCCTGGGG - Intronic
954685133 3:52366097-52366119 TAGGAGTCAGCACTTACTTGGGG + Intronic
955117448 3:56019749-56019771 CAGCAGCAAGGACTTTCTCCTGG + Intronic
955529518 3:59858570-59858592 CAGGAGCGAGGGGTGTCTTGTGG + Intronic
957741074 3:84269519-84269541 CATGAGCCAGGATTTAATTGTGG - Intergenic
958460777 3:94392014-94392036 TAGAAACCAGGACTTACTTGAGG + Intergenic
959361681 3:105402264-105402286 TAGGAGGCAGGACTAGCTTGTGG + Intronic
962068700 3:132010873-132010895 CATGTGCCAGGAAGTTCTTGGGG - Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
964173238 3:153795513-153795535 AGGGAGCGAGGACTTTCCTGGGG - Intergenic
964502361 3:157362368-157362390 CAGGGGCCAGGACCTTCCTCAGG - Intronic
964708870 3:159649905-159649927 CAGCAACCAGAACTTTCTGGAGG - Intronic
966020563 3:175203630-175203652 CAGGAGGCAGGACTAGATTGTGG - Intronic
966926193 3:184646119-184646141 CATGAGGAAGGACTTTCTTCTGG + Intronic
968085781 3:195873319-195873341 CGGGAGTCAGGAGTGTCTTGCGG - Intronic
968872125 4:3247468-3247490 GAGGAGCCAGGGCTTCCTAGAGG + Exonic
968901809 4:3435589-3435611 CAGGAGCCAGGAGATGCTGGGGG - Intronic
969854191 4:9985866-9985888 CAGGAGCCAGGCCCTTCTGAAGG + Intronic
970698579 4:18708295-18708317 CAGGAGCCAGGAATAGCTTTGGG - Intergenic
973730392 4:53817004-53817026 CAGAAGCCATGACATTTTTGAGG - Intronic
976402581 4:84623950-84623972 CAGGAGCCAGGTGTTTCAAGAGG + Intronic
976491467 4:85675620-85675642 CAGGAGCTGGGACTTTCTACTGG - Intronic
978391999 4:108236737-108236759 CAAGGGCCAGGACTTTGTTTGGG + Intergenic
980174146 4:129324701-129324723 CAGGAGCCATGACCTTCTATTGG + Intergenic
984493108 4:180460835-180460857 CAGGAGCAAGGATTTTCATTAGG + Intergenic
985174304 4:187185222-187185244 AAGGAGCCAGGACTTGCTCTAGG + Intergenic
986270318 5:6224717-6224739 CTGGAGCCAAGACTTACGTGTGG + Intergenic
986281437 5:6326115-6326137 CAGGAGACAGGACTTCCTCCAGG - Intergenic
986605667 5:9520703-9520725 CTGGAGCTAGGATTTTCTGGAGG - Intronic
989559153 5:42831208-42831230 CAGGAGTTATGACTTCCTTGTGG + Intronic
990987556 5:61654989-61655011 CAGGAGCCAGGGCTGTCCGGGGG - Intronic
992324976 5:75651600-75651622 CAGGAAACAGTCCTTTCTTGGGG + Intronic
993211270 5:84955175-84955197 CAGAAGCTAGGATTATCTTGAGG + Intergenic
994639296 5:102386430-102386452 CAGGGGCCAGGACTGCATTGGGG + Intronic
994750043 5:103726371-103726393 CTGTAGCCATGACTCTCTTGTGG + Intergenic
994801263 5:104380208-104380230 CAGGAGGCAGGACTTGACTGTGG + Intergenic
997941813 5:138164806-138164828 CAGGAGTCAGGACTTAGATGAGG - Exonic
997999633 5:138614664-138614686 CAGGAGCCAAGATTTTTGTGGGG - Intronic
1000082675 5:157862625-157862647 CAGGTGTCAGAACTTCCTTGTGG + Intergenic
1001323100 5:170698992-170699014 CAGAGGCCAGGGCTGTCTTGGGG - Intronic
1001332019 5:170769114-170769136 CATGTGCAAGGACTCTCTTGGGG + Intronic
1005413541 6:25576561-25576583 CAGGAGCCAGGACTTGCATGGGG + Intronic
1005503237 6:26448323-26448345 CAGGAGCCAGTTACTTCTTGTGG + Exonic
1006816715 6:36856118-36856140 AAGCAGCCAGGACTTTGTTCTGG + Intronic
1007192210 6:40029082-40029104 CAGGAGCTAGGAGTTTATAGGGG + Intergenic
1007345288 6:41224274-41224296 CAGGCTCCATGACTTTGTTGGGG - Intergenic
1007810908 6:44485050-44485072 CAGGACCCAGGACATCCATGTGG - Intergenic
1009943099 6:70312345-70312367 TAGGAGGCAGGACTCTCCTGTGG - Intergenic
1010408136 6:75528907-75528929 TAGTATCCAGGACTTTTTTGGGG - Intergenic
1011233192 6:85187149-85187171 CAGGAGGCAGGACTAGATTGCGG + Intergenic
1013874991 6:114814337-114814359 AAGGGCCCAGGACTTTCTTTTGG - Intergenic
1016184058 6:141178971-141178993 CAGGGCCCAGGGCTTTCTTTTGG - Intergenic
1017204829 6:151793370-151793392 CAGGAGGCAGGTCCTTCTGGAGG - Intronic
1017973812 6:159336615-159336637 TAGGAGACAGGAAATTCTTGGGG + Intergenic
1019140214 6:169938044-169938066 CAGGAGCCAGGCCTTTCATCTGG - Intergenic
1020027808 7:4911334-4911356 CAGGTGACAGGACTTCCCTGGGG - Intronic
1021657946 7:22890453-22890475 CAGGAACCAGTATTTTCTTTTGG + Intergenic
1023173412 7:37412279-37412301 CAGGAGCCAGGGCGTTTGTGGGG + Intronic
1024203782 7:47133645-47133667 AAGGGGTCAGGATTTTCTTGAGG + Intergenic
1025898731 7:65726651-65726673 CAGGAGTCGGGACTTGCATGGGG + Intergenic
1028189244 7:87825833-87825855 CTGGATTCTGGACTTTCTTGGGG + Intronic
1028590247 7:92485440-92485462 CAGGGGCCATGACTATATTGTGG - Intergenic
1028774277 7:94659894-94659916 CATGAGCCAGGACTTTGGTAGGG + Intronic
1030189038 7:106792402-106792424 CAGGAGCCTTGGGTTTCTTGTGG - Intergenic
1031017568 7:116592559-116592581 CAGGAGACGGGACTGGCTTGAGG + Intergenic
1031077983 7:117231186-117231208 CAGGGGCCAGGTCTATCTTGTGG + Intergenic
1031077989 7:117231226-117231248 CAGGAGCCAGGTCTGTCTCGTGG + Intergenic
1033864274 7:145669324-145669346 CAGGACCAATGACTGTCTTGGGG + Intergenic
1034044942 7:147917813-147917835 CAGGAGTCTGGACTTTATTCTGG - Intronic
1034083119 7:148298957-148298979 CAGGTGCCATGACTTACTTTAGG - Intronic
1034301012 7:150015372-150015394 CTGGAGCCACCTCTTTCTTGGGG - Intergenic
1034634168 7:152554132-152554154 CAAGAGGCAGGAGTTTGTTGGGG - Intergenic
1034805040 7:154081930-154081952 CTGGAGCCACCTCTTTCTTGGGG + Intronic
1038050212 8:23801956-23801978 GAGGAGACAGGACTTACTTTGGG - Intergenic
1038373072 8:27012089-27012111 CAGGAGGCAGGACCTTCTGTGGG + Intergenic
1039568228 8:38565910-38565932 CAGGAGCGAGGCCTTCCTTCAGG - Intergenic
1039820220 8:41128170-41128192 CAGGTGCCCGGCCTGTCTTGGGG - Intergenic
1039978335 8:42385663-42385685 CAGGAGCCTGGACTTTGTGCTGG - Intergenic
1041345866 8:56897410-56897432 CATGAGCCTGGACTTTCCTGTGG - Intergenic
1041897014 8:62937168-62937190 CAGGAGACAGAACTAACTTGCGG + Intronic
1042431330 8:68710114-68710136 CAGGAGGCAGGACTAGATTGCGG + Intronic
1042571243 8:70167376-70167398 CAGGAGCAAGGACATCCATGCGG - Intronic
1042957842 8:74271139-74271161 CACGAGGCAGGAATTTCTAGAGG + Intronic
1043247524 8:78023930-78023952 CAGTAGCCAGGACTCTATTGTGG + Intergenic
1046387281 8:113520792-113520814 CTGGAAACAGGACTTTCCTGAGG + Intergenic
1047957161 8:129984710-129984732 GAGGACCCAGGACTATTTTGAGG - Intronic
1048295236 8:133209222-133209244 CACGAGTCAGGACTCACTTGTGG + Intronic
1049442764 8:142616794-142616816 CAGGAGCCAGGCCCTTGGTGAGG + Intergenic
1052030746 9:23625934-23625956 CAGGAGCCCTGGCTTTGTTGGGG - Intergenic
1052475120 9:28949876-28949898 CAGGATCCAGTATTTTATTGAGG - Intergenic
1055373813 9:75627234-75627256 TAGGAGACAGGTCTTTCTTCAGG + Intergenic
1056580608 9:87886285-87886307 CAGGAGGCCGGCCTCTCTTGGGG - Exonic
1057840413 9:98481517-98481539 TAGGCTCCAGGAATTTCTTGAGG - Intronic
1059259859 9:112965433-112965455 CACTGGCCAGGAGTTTCTTGAGG - Intergenic
1059417455 9:114170750-114170772 TGGGAGCCACCACTTTCTTGTGG + Intronic
1060205188 9:121678683-121678705 CGAGAGCCCGGCCTTTCTTGAGG - Exonic
1060795128 9:126507995-126508017 CACGTGCCAGGTCTTTCTGGGGG + Intergenic
1060796011 9:126513745-126513767 CAGCAACCAGGGCTTTCTGGAGG + Intergenic
1060951972 9:127609790-127609812 CAGGATCCAGGACTTCTTAGTGG - Intergenic
1062120203 9:134829994-134830016 CAGGAGCCCGGGTTTTCTTTGGG - Exonic
1062457980 9:136649028-136649050 CAGGAGGGAGAACTTTCCTGTGG - Intergenic
1186638944 X:11434550-11434572 CTGAAGCCAGGGGTTTCTTGAGG - Intronic
1189725130 X:43960620-43960642 AAAGAGCCAGAACTTTCTTGGGG + Intronic
1192446208 X:71213458-71213480 AAGGAGGCAGGACTGTGTTGAGG - Intergenic
1192903250 X:75522628-75522650 GAAGAGCCAGGACATTATTGTGG + Intronic
1193460299 X:81783465-81783487 CAGGAGGCATTACTTTCTTCAGG + Intergenic
1194174522 X:90629671-90629693 CAGGACATGGGACTTTCTTGGGG - Intergenic
1195439588 X:104885560-104885582 CAGGACCCAGGGCTTGCTTTTGG - Intronic
1195504404 X:105640856-105640878 CAAGAGCCTGGACTTACTGGAGG - Intronic
1197518775 X:127472312-127472334 CAGGAGGCAGGACTAGATTGCGG + Intergenic
1197545129 X:127815322-127815344 TAGGAGGCAGGACTAACTTGCGG + Intergenic
1199160263 X:144601203-144601225 CAGAAACCAGGACTATCTTGAGG - Intergenic
1199795461 X:151191450-151191472 CAGATGGAAGGACTTTCTTGAGG - Intergenic
1201555749 Y:15263527-15263549 CATGGTCCAGGACTTTCTTTTGG - Intergenic
1201743979 Y:17351138-17351160 CAGGGCCCAGGGCTTTCTTTTGG + Intergenic
1202601034 Y:26593205-26593227 AAGTTGCCAGGACTTTCTTCTGG + Intergenic