ID: 1145124579

View in Genome Browser
Species Human (GRCh38)
Location 17:20289591-20289613
Sequence CTACTGTGCCTGGCCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1333
Summary {0: 1, 1: 5, 2: 62, 3: 310, 4: 955}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145124575_1145124579 8 Left 1145124575 17:20289560-20289582 CCCAAAAAGTGCTGGGATTAACA 0: 1
1: 2
2: 21
3: 235
4: 1379
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955
1145124569_1145124579 24 Left 1145124569 17:20289544-20289566 CCATCCGCCTAGGCCTCCCAAAA 0: 3
1: 162
2: 5535
3: 79319
4: 193820
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955
1145124574_1145124579 11 Left 1145124574 17:20289557-20289579 CCTCCCAAAAAGTGCTGGGATTA 0: 73
1: 141
2: 253
3: 615
4: 838
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955
1145124570_1145124579 20 Left 1145124570 17:20289548-20289570 CCGCCTAGGCCTCCCAAAAAGTG 0: 2
1: 34
2: 155
3: 1951
4: 24754
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955
1145124571_1145124579 17 Left 1145124571 17:20289551-20289573 CCTAGGCCTCCCAAAAAGTGCTG 0: 1
1: 51
2: 106
3: 189
4: 569
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955
1145124576_1145124579 7 Left 1145124576 17:20289561-20289583 CCAAAAAGTGCTGGGATTAACAA 0: 1
1: 3
2: 26
3: 201
4: 2008
Right 1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG 0: 1
1: 5
2: 62
3: 310
4: 955

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145124579 Original CRISPR CTACTGTGCCTGGCCAAAAA GGG Intronic
900773409 1:4563588-4563610 CCACTGAGCCTGGCTAAAATGGG + Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900961664 1:5925900-5925922 CCACCGTGCCTGGCCAGGAATGG + Intronic
900983125 1:6057861-6057883 CCACTGTGCCTGGCCATGACTGG - Intronic
901373705 1:8822277-8822299 CCACTGTGCCCGGCCAGAATTGG - Intergenic
901407587 1:9059819-9059841 CCACTGTGCCCGGCCTAAAGAGG + Intronic
901430646 1:9212160-9212182 CCACTGTGCCCGGCCTAAATTGG - Intergenic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901513745 1:9731460-9731482 CGGCTGTGCCTGGTCAAAACGGG + Intronic
901707833 1:11089668-11089690 CCACTGTGCCTGGCCAGAGCTGG - Intronic
901813962 1:11783532-11783554 CCACTGTGCCTGGCCGTAGATGG + Intronic
902025397 1:13379686-13379708 CCACAGTGCCTGGCCTCAAATGG - Intergenic
902030766 1:13420494-13420516 TTACTGCGCCAGGCCTAAAATGG + Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902351589 1:15859654-15859676 CCACTGTGCCCGGCCTGAAAAGG + Intronic
902360237 1:15938401-15938423 CCACTGTGCCTGGCCAGTAACGG + Intronic
902718148 1:18286892-18286914 CCACTGTGCCTGGCCGAAGATGG - Intronic
902815079 1:18911824-18911846 CCACTGCGCCTGGCCCAAAGGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
902900860 1:19514984-19515006 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
902915494 1:19636610-19636632 CCACTGCGCCTGGCCAAGAGTGG - Intronic
903107777 1:21098922-21098944 CCACTGTGCCTAGCCTCAAATGG + Intronic
903256172 1:22102148-22102170 CCACTGGGCCTGGCCAAATACGG + Intergenic
903412498 1:23157387-23157409 CCACTGTGCCTGGCCTAGGACGG - Intronic
903785991 1:25861725-25861747 CCACTGCGCCTGGCCGACAAAGG - Exonic
903851577 1:26310086-26310108 CCACTGTGCCCGGCCCAAAAAGG + Intronic
903944679 1:26954509-26954531 CCACTGCGCCTGGCCAAATGTGG + Intronic
904010871 1:27389628-27389650 CCACTGTGCCCAGCCCAAAATGG - Intergenic
904082069 1:27878470-27878492 CCAGTGTGCCCAGCCAAAAACGG + Intronic
904101779 1:28036100-28036122 CCACTGCGCCCGGCCTAAAATGG + Intronic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904223219 1:28990703-28990725 CCACTGTGCCTGGCCTCAAGGGG + Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904665851 1:32120812-32120834 CTACTGTGGGAGGCCAAAGAGGG - Intronic
905071725 1:35232164-35232186 CCACTGTGTCTGGCCTAAAAAGG - Intergenic
905164878 1:36074353-36074375 CCACTGTGCCTGGCCAGTGAGGG + Intergenic
905178528 1:36152935-36152957 CCACTGTGCCTGGCCAGGATAGG + Intronic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905598873 1:39233319-39233341 CCACTGTGCCTGGCCAACCCAGG + Intronic
905779745 1:40698073-40698095 CCACTGTGCCTGACCAGACATGG - Intronic
905877838 1:41444597-41444619 TTACTGTGCCAGGCCAAGAAGGG + Intergenic
905960978 1:42041870-42041892 CCACTGCGCCTGGCCTAAAGAGG - Intergenic
906003187 1:42445093-42445115 CCACCGTGCCCGGCCAGAAAGGG + Intronic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906173346 1:43747051-43747073 CCACTGCGCCTGGCCTAAAATGG + Intronic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906308638 1:44737828-44737850 CCACTGTGCCTGGCCAGGAAAGG - Intergenic
906339238 1:44963555-44963577 CCACTGTGCCTGGCCAACCAGGG + Intronic
906393845 1:45443189-45443211 CCACTGTGCCCGGCCAACTAAGG + Intronic
906975966 1:50573384-50573406 CCACTGTGCCTGGCCTGAAGCGG + Intronic
906980281 1:50621876-50621898 CCACTGTGCCTGGCCAGCAGGGG - Intronic
907121236 1:52009890-52009912 GTACTGTGGCTGGCAGAAAAGGG + Intergenic
907174535 1:52506103-52506125 CTACTGCGCCTGGCCAATGAGGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907212655 1:52836971-52836993 CTACTGCGCCTGGCCTTAAATGG - Intergenic
907281081 1:53347546-53347568 CCACTGTGCCCGGCCTATAAAGG + Intergenic
907361275 1:53917536-53917558 CCACTGCGCCTGACCAAAAAAGG - Intronic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
907799147 1:57747520-57747542 CCACCGTGCCTGGCCTACAATGG - Intronic
907809294 1:57852311-57852333 AAAATGTGCCTGGACAAAAAAGG - Intronic
908662896 1:66456116-66456138 CCACTGCGCCCGGCCAAAAATGG + Intergenic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909815120 1:79983254-79983276 CCACTGTGCCTGGCCACAAAAGG - Intergenic
909853397 1:80498180-80498202 CCACTGTGCCTGGCCCAACACGG - Intergenic
910141301 1:84030135-84030157 CTACTGTGTATGCCCAAATACGG - Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910408755 1:86917229-86917251 CCACCGTGTCTGGTCAAAAATGG - Intronic
910506005 1:87950916-87950938 CCACCGTGCTTGGCCAAACATGG - Intergenic
910956616 1:92713486-92713508 CCACTGCGCCTGGCCAGAAAGGG - Intronic
910983168 1:92978507-92978529 CCACCGTGCCCGGCCAATAAGGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911312100 1:96305954-96305976 CTACTGTGCCAGGCCATTATTGG - Intergenic
911345139 1:96688032-96688054 CCACTGCGCCTGGCCTAAAGTGG - Intergenic
912816543 1:112833282-112833304 CCACTGTGCCTGGCCTAATATGG + Intergenic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913146520 1:115995536-115995558 CTACTGTGCCCAGCCCAAAATGG + Intronic
914357281 1:146897943-146897965 CCACAGTGCCTGGCCACAATGGG - Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914672352 1:149880804-149880826 CCACTGTGCCTGACCAATAGTGG - Intronic
914795898 1:150920149-150920171 CCACAGTGCCCGGCCAAGAAGGG - Intergenic
915185419 1:154100883-154100905 CCACTGTGCCTGGCCCAAGATGG - Intronic
915211214 1:154310998-154311020 CCACCGTGCCCGGCCAAAGATGG + Intergenic
915412283 1:155711203-155711225 CTACTGTGCCCGGCCGAGAGAGG - Intronic
915467455 1:156105829-156105851 CCACCGTGCCTGGCCAGATAAGG - Intronic
916100797 1:161391531-161391553 CCACTGTGCCTGGCCCGAAGTGG + Intergenic
916408416 1:164520811-164520833 CCACCGTGCCTGGCCAGAGAAGG - Intergenic
916530801 1:165654401-165654423 CCACTGTGCCTGGCCAGCATAGG - Intronic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917379687 1:174391627-174391649 CCACTGTGCCCAGCCAAGAAAGG + Intronic
917541019 1:175914908-175914930 CCACTGAGCCTGGCCAGCAAGGG - Intergenic
917902241 1:179554199-179554221 CCACTGCGCCTGGCCTAAAATGG + Intronic
918767933 1:188512882-188512904 CCACTGTGCCCGGCCATATATGG - Intergenic
919007861 1:191922934-191922956 CCGCTGTGCCTGGCCAGAAAGGG - Intergenic
919959729 1:202454644-202454666 CTACCATACCTGGCCAAGAAGGG - Intronic
920057741 1:203205186-203205208 CCCCTGTGCTTGGCCAAGAAAGG + Intergenic
920082430 1:203385037-203385059 CCACTGCACCTGGCCAAGAATGG - Intergenic
920500822 1:206484276-206484298 CCACTGTGCCAGGCCTAAACTGG + Intronic
921125766 1:212176586-212176608 CCACGGTGCCTGGCCAGAAAAGG + Intergenic
921211519 1:212903390-212903412 CCACTGTGCCTGGCCTTAATGGG + Intergenic
921506708 1:215979858-215979880 CTTCTGTTCCTGGTTAAAAAGGG + Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
922295497 1:224246315-224246337 CCACTGTGCCTGGCCGAAGTGGG + Intronic
922296592 1:224255154-224255176 CCAATGTGCCTGGCCCAAAATGG + Intronic
922296645 1:224255477-224255499 CCACCGCGCCTGGCCTAAAATGG + Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922697620 1:227739310-227739332 CCACTGTGCCTGGCCAGGACGGG + Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
922779159 1:228237717-228237739 CCACTGTGCCTGGCCACATATGG + Intronic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
922954025 1:229583934-229583956 CCACTGCACCTGGCCAGAAATGG + Intergenic
923292931 1:232564363-232564385 CCACTGCTCCTGGCCAAGAAAGG + Intergenic
923353061 1:233128620-233128642 CCACTGTGCCCGGCCAACTATGG + Intronic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923418351 1:233787580-233787602 CCACTGTGCCTGGCCTGAAATGG - Intergenic
923727722 1:236522041-236522063 CTGCTGTGCCTGGCCATGATAGG + Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
924505543 1:244680158-244680180 CCACTGTGCCTGGCCATGGATGG - Intronic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
924725969 1:246670947-246670969 CCACTGCGCCTGGCCAGAAAGGG + Intergenic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
1063002244 10:1935395-1935417 CCACTGTGCCTGGCCAATTTTGG + Intergenic
1063117625 10:3082996-3083018 CCACTGTGCCCAGCCACAAAAGG + Intronic
1063231688 10:4071816-4071838 CCACTGTGCCCGGCCAAAAATGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063589893 10:7385710-7385732 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064198007 10:13261169-13261191 CCACTGTGCCTGGTCAAGAAAGG - Intergenic
1064212331 10:13370514-13370536 CTACTGTGCCTGGCCTAAAATGG + Intergenic
1064264982 10:13818836-13818858 CCACCGTGCCTGGCCATACATGG - Intronic
1064294133 10:14062774-14062796 CCACTGTGCCTGGCCAGGACTGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1064862393 10:19841986-19842008 CCACTGTGCCTGGCCTCAAGTGG - Intronic
1065006279 10:21383209-21383231 CCACCGCGCCTGGCCAAAAGAGG + Intergenic
1065050469 10:21786756-21786778 CCACTGTGCCTGGACTAAAACGG + Intronic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1065295843 10:24274216-24274238 CCATTGTGCCTGGCCAGCAATGG - Intronic
1065322532 10:24522707-24522729 CCACTGTGCCTGGCCAGTGAAGG - Intronic
1065359683 10:24877906-24877928 CCACTGTGCCTGGCCAGAATAGG + Intronic
1065537192 10:26726772-26726794 CCACCGTGCCCGGCCTAAAATGG - Intronic
1065683806 10:28264007-28264029 CCACTGTACCTGGCCTAGAATGG - Intronic
1065684081 10:28266245-28266267 CTACTGTGCCCAGCCCACAAGGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066045435 10:31590871-31590893 CTACCATGCCCGGCCTAAAAGGG - Intergenic
1066097717 10:32088131-32088153 CCACTGAGCCTGGCCTAGAAAGG - Intergenic
1066266636 10:33782537-33782559 CCACTGTGCCTTGCCAAGAGTGG - Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066466467 10:35654540-35654562 CCACTGCGCCTGGCCAAGATAGG + Intergenic
1066520640 10:36214370-36214392 CCACTGTGCACGGCCAGAAATGG + Intergenic
1066521626 10:36226394-36226416 CCACTGTGCCTGGCCAGATGAGG + Intergenic
1066559794 10:36657541-36657563 CCACTGCGCCTGGCCTAAATGGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067129298 10:43547098-43547120 CCACTGAGCCTGGCCCCAAAGGG + Intergenic
1067411596 10:46069467-46069489 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1067481259 10:46599606-46599628 CCACTGCGCCTGGCCTAACAGGG - Intergenic
1067488932 10:46679690-46679712 CCACTGAACCTGGCCAAAAGTGG - Intergenic
1067605737 10:47660686-47660708 CCACTGAACCTGGCCAAAAGTGG + Intergenic
1067613492 10:47742125-47742147 CCACTGCGCCTGGCCTAACAGGG + Intergenic
1067765059 10:49079117-49079139 CCACTGTGCCTGGCCAGAAATGG + Intronic
1067858742 10:49821665-49821687 CCAATGTGCCTGGCCAAAGAGGG + Intronic
1068448926 10:57162034-57162056 CCACTGTGCCTGGCCAATGAGGG - Intergenic
1069268009 10:66487512-66487534 CCACTGTGCCCGGCCTAAAAGGG + Intronic
1069357882 10:67608801-67608823 CCACTGCCCCTGGCCAGAAATGG - Intronic
1069411167 10:68154890-68154912 CCACCGTGCCTGGCCTGAAATGG - Intronic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1069561602 10:69434915-69434937 CCACTGTGTCTGGCCCCAAATGG - Intergenic
1069583528 10:69581265-69581287 CCACTGCGCCTGGCCAGAAAGGG + Intergenic
1069777396 10:70934984-70935006 TTACTGTGCCTGGGCAAGGAAGG + Intergenic
1069788493 10:71004796-71004818 CTCCTGGGACTGGCCAAACAGGG - Intergenic
1069927306 10:71859725-71859747 CCACCGTGCCTGGCCTTAAATGG - Intergenic
1069970739 10:72166313-72166335 CCACTGTGCCTGGCTAGAAAAGG - Intronic
1070121251 10:73579465-73579487 CCACTGCGCCTGGCCAAAATTGG - Intronic
1070287815 10:75096287-75096309 CCACAGTGCCTGGCCTGAAAAGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071129242 10:82372156-82372178 CTACTCTTGCTGGCCAACAAAGG + Intronic
1071475577 10:86022628-86022650 CCACTGCACCTGGCCAAAAAAGG - Intronic
1071621296 10:87122050-87122072 CCACTGAACCTGGCCAAAAGTGG + Intronic
1071671447 10:87612735-87612757 CCACTGTGCCCGGCCAAGACTGG - Intergenic
1072049493 10:91689305-91689327 CCACCGTGCCTGGCCTACAAAGG - Intergenic
1072107017 10:92284012-92284034 CCACTGTGCCCGGCCCAGAATGG + Intronic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072896675 10:99373251-99373273 CCACTTTGCCTGGCCAGACATGG - Intronic
1073282461 10:102364559-102364581 CCACTGCGCCCGGCCAGAAAGGG - Intronic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073388581 10:103151174-103151196 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1073990347 10:109254850-109254872 CCACTGTGCCCAGCCAAAACTGG + Intergenic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074095555 10:110308837-110308859 CCACCGGGCCTGGCCAGAAATGG + Intergenic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074168614 10:110909479-110909501 CCACCGTGCCCGGCCAGAAAAGG + Intronic
1074338993 10:112607506-112607528 GCACAGTGCCTGGCCTAAAATGG + Intronic
1074369970 10:112892627-112892649 CCACTGTGCCTGGCCAGGTATGG - Intergenic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1075499573 10:122960556-122960578 CCACTGTGCCTGGCCATCCAAGG + Intronic
1075631882 10:124005357-124005379 CTCCTGTGCTTGGCCGAATACGG + Intergenic
1075987568 10:126800693-126800715 CCACTGTGCCCGGCCTAAAATGG - Intergenic
1077608456 11:3627985-3628007 CCACCGTGCCTGGCCAAATTTGG - Intergenic
1077952061 11:6970067-6970089 CCACTGTGCCTGGCCAGCATTGG + Intronic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078261659 11:9715264-9715286 CTACTGTGCAGGGCCTAAAAGGG + Intronic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078694649 11:13619441-13619463 CCACTGCGCCTGGCCAGCAATGG - Intergenic
1079026673 11:16954226-16954248 CCACTGTGCCTGGCCATTATTGG - Intronic
1079072339 11:17357988-17358010 CTACCATGCCTGGCCAACAGTGG + Intronic
1079606460 11:22375083-22375105 CCACCGTGCCTGGCCACAAATGG - Intronic
1080799056 11:35592620-35592642 CCACCGTGCCTGGCCAGCAATGG - Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081818408 11:45967079-45967101 CCACTGTGCCCGGCCAGGAAAGG - Intronic
1082026285 11:47574925-47574947 CCACTGTGCCTGGCCTAACCTGG - Intronic
1082041392 11:47688244-47688266 TCACTGTGCCTGACCAGAAATGG + Intronic
1082070221 11:47933606-47933628 CTACTGCACCTGGCCAAATCTGG - Intergenic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082760261 11:57120548-57120570 CTACTTTGCCTTTCCAAAAGGGG - Intergenic
1083131268 11:60624906-60624928 CCACTGTGGCTGGCCAAAATAGG - Intergenic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083444344 11:62697498-62697520 CCACTGTGCCGGGCCCAAAGCGG - Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083991436 11:66248330-66248352 CCACCGTGCCCGGCCAAAATAGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084050740 11:66597961-66597983 CCACTGCGCCTGGCCTAAATGGG - Intronic
1084152320 11:67294795-67294817 CCACCGTGCCTGGCCACTAAGGG + Intronic
1084278267 11:68067918-68067940 CTGCTGAGCCTGGCAAACAAGGG + Intronic
1085275599 11:75296945-75296967 CCACTGTGCCCAGCCAACAATGG + Intronic
1085404740 11:76255090-76255112 CTACTGTGCCTCTCCAGAGAGGG + Intergenic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085620696 11:78035870-78035892 CCACTGTGCCCGGCCATGAAGGG - Intronic
1085846616 11:80073185-80073207 CTACTGTGCCCAACCAAACAAGG + Intergenic
1086091524 11:83009351-83009373 CCACCGCGCCCGGCCAAAAACGG + Intronic
1086314949 11:85581323-85581345 CCACTGTGCCTGGCCAGAGAAGG - Intronic
1087293590 11:96344237-96344259 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088632944 11:111791802-111791824 CCACTGTGTCTGGCCAAAGGAGG - Intronic
1088637921 11:111842182-111842204 CCACTGTGCCTGGCCTAAGGTGG + Intronic
1089408937 11:118222126-118222148 CCACTGTGCCTGGCCAGCAGGGG - Intronic
1089420129 11:118325841-118325863 CCACCGTGCCTGGCCAGATATGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089488206 11:118863500-118863522 CCACTGTGCCTGACCCTAAATGG - Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090108916 11:123883864-123883886 CTGCTGTGCCTGGCCTCAGAGGG - Intronic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090584704 11:128198784-128198806 CCACTGTGCCTGGCCCCCAATGG - Intergenic
1091488471 12:912572-912594 CCACTGTGTCTGGCCAGAAAAGG - Exonic
1091491069 12:933169-933191 CCACTGTGCCTGGCCGCATAAGG - Intronic
1092338850 12:7658349-7658371 CCACCGTGCCCGGCCAAAATTGG + Intronic
1092340965 12:7675781-7675803 CCACTGTGCCCGGCCAAAATTGG - Intergenic
1092393279 12:8100696-8100718 CCATTGTGCCTGGCCCAAAGAGG + Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092741214 12:11631895-11631917 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1093032157 12:14298185-14298207 CCACCGTGCCTGGCCAGGAATGG - Intergenic
1093318736 12:17685379-17685401 CCATGGCGCCTGGCCAAAAAGGG - Intergenic
1093466229 12:19452278-19452300 CAACTGCTCCTGGCCAAAAGTGG + Intronic
1093483061 12:19625221-19625243 CCACCGTGCCTGGGCTAAAATGG - Intronic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093832067 12:23773657-23773679 CCACTGTGCCTGGCCTACCAGGG + Intronic
1093916560 12:24808721-24808743 CCACTGCGCCTGGCCAAGATTGG + Intergenic
1094090913 12:26648232-26648254 CCACTGAGGCTGGCAAAAAATGG + Intronic
1094256086 12:28428281-28428303 CCACTACGCGTGGCCAAAAAGGG - Intronic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1094620601 12:32076861-32076883 CCACTGTGCCTGGCCTAACATGG + Intergenic
1095511928 12:42960451-42960473 ATAGTGTGCCTGTCCAAAACAGG + Intergenic
1096054256 12:48637814-48637836 CCACTGTGCTTGGCCAGATAGGG - Intergenic
1096419572 12:51445453-51445475 CCGCTGTGCCTGGCCAGAAGTGG + Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1096486960 12:51989570-51989592 CCACTGTGCCTGGCCTAAATTGG + Intronic
1097003298 12:55896656-55896678 CCACTGAGCCTGGCCAATAATGG + Intergenic
1097021858 12:56026400-56026422 CCACTGCGCCTGGCCCAGAATGG - Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097583144 12:61482757-61482779 CCACTGTGCCTGGCCACTAATGG - Intergenic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1097764882 12:63514556-63514578 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1098224008 12:68301964-68301986 CCACTGTGCCTGGCCAGGAGAGG + Intronic
1098434396 12:70453324-70453346 CCACCGTGCCTGGCCAAATTAGG - Intergenic
1099225244 12:79961217-79961239 CCACTGCGCCCGGCCAAAACCGG + Intergenic
1099406167 12:82265982-82266004 CCACTGCGCCTGGCCTGAAATGG - Intronic
1099460775 12:82918194-82918216 CCACTGCGCCTGGCCAAAATTGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1100034712 12:90236497-90236519 CCACTATGCCCGGCCAAAATTGG - Intergenic
1100375535 12:94013015-94013037 CCACTGCACCTGGCCAAGAAAGG - Intergenic
1100406764 12:94278708-94278730 CCACTGTGCCCGGCCCAAAGAGG - Intronic
1100507184 12:95233687-95233709 CCACTGTGCCTGGCCAATGTTGG + Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100700342 12:97140539-97140561 CCACAGTGCCTGGTCAAAAGAGG - Intergenic
1100844103 12:98642435-98642457 CCACTGCACCTGGCCCAAAAAGG + Intronic
1101693246 12:107100738-107100760 ACACTGTGCCTGGCTAAAAAGGG + Intergenic
1102083056 12:110113913-110113935 CCACTGTGCCCGGCCTCAAAAGG + Intergenic
1102105033 12:110314000-110314022 CCACTGTGCCCGGCCGATAATGG + Intronic
1102353868 12:112215918-112215940 CCACTGTGCCTGGCCCAATAAGG + Intronic
1102359011 12:112267475-112267497 CTACTGCACCTGGCCTAAAAAGG + Intronic
1102361967 12:112295947-112295969 CCACTGTGCCTGGCCTGATAAGG + Intronic
1102515807 12:113445877-113445899 CTCATGTGCCTGGTCAAAATTGG + Intergenic
1102823204 12:115925381-115925403 CTACTGTGCCCAGCCAAACATGG + Intergenic
1103374172 12:120442270-120442292 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103469476 12:121168554-121168576 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1103487198 12:121291105-121291127 CCACTGTGCCTGGCCAGCAATGG + Intronic
1103495613 12:121359940-121359962 TCACTGCGCCTGGCCTAAAATGG - Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1103680580 12:122690441-122690463 CCACTGTGCCCGGCCATAAAGGG - Intergenic
1103729876 12:123020406-123020428 CCACTGTGCCCGGCCATAAAAGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1105275450 13:18919059-18919081 CCACTGTGCCCGGCCAAATTTGG + Intergenic
1105395591 13:20030819-20030841 CCACTGCGCCTGGCCAACATAGG + Intronic
1105451952 13:20507951-20507973 CCACTGTGCCTGGCCAGGCATGG - Intronic
1105527927 13:21192803-21192825 CCACTGCGCCCGGCCACAAATGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106391336 13:29338077-29338099 CCACTGTGCCTGGCCATGACCGG + Intronic
1106456089 13:29928626-29928648 CCACTGCGCCTGGCCTAAAATGG - Intergenic
1106465197 13:30007343-30007365 GGACTGTTCCTGGCCAAAGATGG - Intergenic
1107040463 13:35942468-35942490 CCACTGCGCCTGGCCTCAAAAGG + Intronic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107332288 13:39314148-39314170 CCACTATGCCTGGCCAATAAAGG - Intergenic
1107507800 13:41052561-41052583 CGACTGTGCCTGGCCAAGGAAGG - Intronic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108679564 13:52768014-52768036 ATACTGTGCCTTGAGAAAAATGG - Intergenic
1109043691 13:57378532-57378554 CTACTGCGCCAGGCCAAGACTGG - Intergenic
1109393303 13:61721358-61721380 CCACTGTGCCCGGCCAAAATTGG + Intergenic
1109420401 13:62104333-62104355 CCACTGCGCCTGGCCAACAAAGG + Intergenic
1110791029 13:79586896-79586918 CTACTGTACCTGGCCTTAATTGG + Intergenic
1111795874 13:92918968-92918990 CCACCGTGCCTGGCCACTAATGG + Intergenic
1112006008 13:95254183-95254205 CCACTGCGCCTGGCCTAAAGGGG + Intronic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1112510301 13:100003037-100003059 CCACTGTGCCTGGCCAGAGATGG + Intergenic
1112514084 13:100036969-100036991 CCACTGAGCCCAGCCAAAAAAGG + Intergenic
1112672269 13:101653995-101654017 CCACTGTGCCTGGCCTGAGAAGG + Intronic
1112675324 13:101694707-101694729 CCACTGAGCCTGGCCAGAAATGG + Intronic
1112962016 13:105138606-105138628 CCACTGCGCCTGGCCCATAAAGG - Intergenic
1113466924 13:110519597-110519619 CCACTCTGCCTGGCCACAGAAGG + Intergenic
1113787150 13:113008203-113008225 CCACTGTGCCCGGCCAAGTACGG + Intronic
1114469142 14:22947069-22947091 CCACTGTGCCCAGCCAAAAATGG + Intronic
1114970866 14:28026827-28026849 CCACTGTGCCCGGCCAAGGAGGG + Intergenic
1115144142 14:30206855-30206877 CTCCTGTGCCCGACAAAAAAAGG - Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115246286 14:31299430-31299452 CCACTGTGTCTGGCCACGAAAGG - Intronic
1115704242 14:35982052-35982074 CCACTGTGCCTGGTCAGCAATGG + Intergenic
1115965238 14:38880179-38880201 CCACTGCACCTGGCCAAAACAGG + Intergenic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116171771 14:41411726-41411748 CCACCGTGCCTGGTCGAAAATGG - Intergenic
1116229571 14:42199316-42199338 TCACTGTGCCTGGCCCTAAATGG - Intergenic
1116492177 14:45517656-45517678 CCACTGCGCCTGGCCCAGAAAGG + Intergenic
1116523120 14:45873202-45873224 CCACTGTGCCTGGCCACAAGTGG - Intergenic
1116558953 14:46352103-46352125 CCACTGTGCCTGGCCTTAATAGG + Intergenic
1117273402 14:54167873-54167895 CTACTGTCCTTGGCATAAAATGG + Intergenic
1117682882 14:58223423-58223445 CCACTGCACCTGGCCAAAACAGG + Intronic
1118208328 14:63744022-63744044 CTACGGTGCCTGGCCCAGAGGGG + Intergenic
1118227304 14:63913988-63914010 CCACTGTGCCTGGCCATAAATGG + Intronic
1118325339 14:64776727-64776749 CCACTGCGCCCGGCCTAAAAGGG + Intronic
1118648597 14:67865823-67865845 CCACTGCGCCTGGCCTAAATTGG + Intronic
1118833013 14:69452615-69452637 CTACTGTGCCCGGCCAAGGGTGG + Intronic
1119012438 14:71008367-71008389 CCACTGCGCCCGGCCAAAACAGG - Intronic
1119050041 14:71358147-71358169 CCACTGTGCCCGGCCAACACTGG + Intronic
1119253923 14:73182059-73182081 CCACTGTGCCTGGCCTGAAAGGG + Intronic
1119263017 14:73249384-73249406 CCACTGTGCATGGCCATAACAGG - Intronic
1119516996 14:75256140-75256162 CTACCATGCCAGGCCTAAAATGG + Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1119707605 14:76794382-76794404 CCACTGCGCCTGGCCTAAAGGGG - Intronic
1119732454 14:76959461-76959483 CAACTGTGTCTGGACAGAAATGG - Intergenic
1119942829 14:78659389-78659411 CTACCATGCCCAGCCAAAAATGG - Intronic
1120535689 14:85692109-85692131 CCACTGTGCCATGCCAAATATGG - Intergenic
1120975172 14:90242032-90242054 CCACTGTGCCCAGCCAAGAAAGG + Intergenic
1121008411 14:90505090-90505112 CCATTGTGCCTGGCCAAACAGGG - Intergenic
1121126370 14:91409460-91409482 CCACTGTGCCCAGCCTAAAACGG + Intronic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121147317 14:91595574-91595596 CTTCTGTGCCTGTCAGAAAATGG + Intronic
1121154532 14:91670714-91670736 CCACTGCGCCTGGCCAAAAGTGG - Intronic
1121382556 14:93486367-93486389 CCACTGTGCCTGGCCCCAAGAGG - Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1122450025 14:101798477-101798499 CCACTGTGCCTGGCTTGAAAAGG - Intronic
1122532248 14:102436605-102436627 CTGCTGTGCCTGGCCAAGGGTGG + Intronic
1122686327 14:103509397-103509419 CCACTGTGCCTGGCCTTTAATGG - Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1124404414 15:29381167-29381189 CCACTGCGCCTGGCCAACAAGGG - Intronic
1124415176 15:29467735-29467757 CTTCTGTGCCTGGCCATAGATGG - Intronic
1124577282 15:30921090-30921112 CCACTGTGCCTGGCCAACGAGGG + Intronic
1124798017 15:32801477-32801499 CCACTGTGCCCGGCCAAATAAGG - Intronic
1124929565 15:34106143-34106165 CCACTGTGCCCGGCCCAGAAAGG - Exonic
1125487051 15:40118758-40118780 CCACTGAGCCTGGCCAACACTGG - Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126043133 15:44612094-44612116 CCACTGCGCCTGGCCTAAAATGG + Intronic
1126133725 15:45370087-45370109 CAACCATGCCTGGCCAATAATGG - Intronic
1126545506 15:49869197-49869219 CCACTGAGCCTGGCCAGAAATGG + Intronic
1126607086 15:50488858-50488880 CCACTGTGCCCGGCCAAACCTGG + Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1126925949 15:53586606-53586628 CTACTAAGCCTTGCCTAAAAAGG - Intronic
1126983447 15:54273859-54273881 GTACTGTCCCTGGCCAAACTGGG + Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127302988 15:57675794-57675816 CAACTGTGCCTGGCCTCAAGAGG + Intronic
1127424701 15:58844258-58844280 CCACCGTGCCCGGCCAACAATGG - Intronic
1127897143 15:63311229-63311251 GTACTGTGCCTGGCCAAGAGAGG + Intergenic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1128057497 15:64711302-64711324 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128881573 15:71247972-71247994 CAACTGAGTCTGGCCAGAAAAGG - Intronic
1128947576 15:71839695-71839717 CTACTGTGCCTGGCCTGAATCGG + Intronic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129739462 15:77983177-77983199 CCACTGCGCCTGGCCTAATACGG + Intergenic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130986582 15:88848427-88848449 CCACTGTGCCCAGCCTAAAAAGG - Intronic
1131166559 15:90145892-90145914 CCACTGTGCCTGGCCTTGAATGG - Intergenic
1131373856 15:91907491-91907513 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1131509498 15:93041872-93041894 CCACCGTGCCCGGCCAAAAAAGG - Intronic
1132057338 15:98662266-98662288 CCACTGTGGCTGGCCAAGGAGGG + Intronic
1132126811 15:99234657-99234679 CCACCGCACCTGGCCAAAAATGG + Intronic
1132177400 15:99726429-99726451 CCACTGTGCCTGGCCCCAAGTGG + Intronic
1132243835 15:100279568-100279590 GCACAGTGCCTGGCCACAAATGG - Intronic
1132272710 15:100540253-100540275 CCACTGCGCCTGGACAAGAAAGG - Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1132866711 16:2096802-2096824 CCACCGCGCCCGGCCAAAAATGG + Intronic
1132979806 16:2731495-2731517 CCACCGCGCCTGGCCAAAAATGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133500290 16:6359378-6359400 CCACTGCACCTGGCCTAAAAAGG + Intronic
1133641359 16:7720505-7720527 CTACTGTGCCTGGCCAGATGTGG - Intergenic
1133730277 16:8572721-8572743 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1133759429 16:8786433-8786455 CCACCGTGCCTGGCCATCAAAGG + Intronic
1133785278 16:8968485-8968507 CCACTGTGCCTGGCCACACCCGG - Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133945008 16:10340734-10340756 CCACTGTGCCCAGCCAAAATAGG - Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134596043 16:15496823-15496845 CCACTGTGCCAGGCCCACAAGGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135147636 16:19976560-19976582 CCACTGTGCCTAGCCAAAATTGG + Intergenic
1135519563 16:23164387-23164409 CCACTGTGCCTGGATGAAAATGG - Intergenic
1135586167 16:23672838-23672860 CCACTGCGCCTGGCCAAACATGG - Exonic
1135960420 16:26990268-26990290 CCACTGTACCTGGCCACATATGG - Intergenic
1136224467 16:28849382-28849404 CCACTGTGCCCAGCCTAAAAGGG + Intronic
1136373239 16:29848956-29848978 CAACTGTTCCTGGCCCCAAAGGG - Intergenic
1136396868 16:29997466-29997488 CCACTGCACCTGGCCAAGAATGG - Intronic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136851964 16:33619260-33619282 CCACTGCGCCCGGCCAAGAAAGG + Intergenic
1137463326 16:48685811-48685833 CCACTGCGCCTGGCCCAAATAGG - Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1137932678 16:52603677-52603699 TCACTGTGCCTGGCCCAAAATGG + Intergenic
1137975762 16:53030551-53030573 CCAACGTGCCTGGCCTAAAAGGG - Intergenic
1138048430 16:53750524-53750546 CCACTGTGCTCGGCCAATAATGG + Intronic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1138653902 16:58479179-58479201 CCACTGTGCCCAGCCATAAATGG + Intronic
1139258538 16:65568057-65568079 CCACTGTGCCTGGCTAACAATGG - Intergenic
1139328859 16:66172275-66172297 CTTCTATGCCTGACCAAAAGCGG + Intergenic
1139401809 16:66687972-66687994 CCACCGCGCCTGGCCAAAATGGG + Intronic
1139414762 16:66799513-66799535 CCACCGTGCCTGGCCTAAGAGGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139620795 16:68140270-68140292 CCACTGCGCCTGGCCAGAAAGGG + Intronic
1139724675 16:68887587-68887609 CCACTGTGCCTGGCCCTAGAAGG - Intronic
1139768945 16:69256880-69256902 CCACTGTGCCTGGCCTTAATTGG - Intronic
1139897307 16:70298004-70298026 CTACTGTGCCTGGCCAATCCTGG + Intronic
1140293346 16:73684984-73685006 CCACTGTGCCAGGCCCAACAAGG + Intergenic
1141136763 16:81470743-81470765 CCACTGTGCCCAGCCAAAATTGG + Intronic
1141202189 16:81906709-81906731 CCACTGTACCCAGCCAAAAATGG + Intronic
1141340900 16:83202936-83202958 CCACTGTACCTGGCCCCAAAAGG - Intronic
1141580538 16:84995336-84995358 CCACTGTGCCCGGCCTGAAACGG - Intronic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1141878655 16:86843364-86843386 CCACCGCGCCCGGCCAAAAAAGG - Intergenic
1141939904 16:87268633-87268655 CCACTGTGCCTGGCCAGGACAGG - Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142704622 17:1686799-1686821 CCACCGTGCCAGGCCAAAAAAGG + Intergenic
1143094363 17:4469372-4469394 CCACTGTGCCTGGCCTCAACTGG + Intronic
1143250488 17:5519733-5519755 CCACTGCGCCTGGCCCATAATGG + Intronic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143429932 17:6873933-6873955 CCACTGTGCCCGGCCATGAAGGG - Intergenic
1143456726 17:7072675-7072697 CTGCAGTGCTTGGCCACAAAAGG - Intergenic
1144649556 17:16998590-16998612 CCACTGCGTCTGGCCTAAAATGG - Intergenic
1145075847 17:19854009-19854031 CCACTGTGCCTGGCCAGAATTGG - Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145127402 17:20313761-20313783 ATACTGTCCCTTTCCAAAAACGG - Intronic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1145956272 17:28856996-28857018 CCACTGCGCCTGGCCAGGAAAGG + Intronic
1146073051 17:29701856-29701878 CCACTGTGCCTGGCCACATTTGG + Intronic
1146378163 17:32308778-32308800 CCACTGTGCCCAGCCAGAAAGGG - Intronic
1146412402 17:32598084-32598106 CCACTGTGCCTGGCCCTAACAGG - Intronic
1146435366 17:32841177-32841199 CCACTGTGCCTGGCCTACAATGG - Intronic
1146898996 17:36569038-36569060 CCACCGTGCCTGGCCTACAAAGG + Intronic
1147023926 17:37564132-37564154 CCACTGTGCCTGGCCAACCCTGG + Intronic
1147111905 17:38268893-38268915 CCACTGTGTCTGCCCTAAAATGG + Intergenic
1147115063 17:38293030-38293052 CCACCGTGCCCAGCCAAAAAGGG - Intergenic
1147172254 17:38628912-38628934 CCACTGTGCCTGGCCATGGAGGG - Intergenic
1147398141 17:40161262-40161284 CCACTGTGCCAGGCCAAAATAGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147532027 17:41288379-41288401 CCACTGTGCCAGGCCAAAATGGG - Intergenic
1147617533 17:41838537-41838559 CCACTGTGCCTGGCCAACTCTGG + Intronic
1147775028 17:42894789-42894811 CCACTGTGCCTGACCTAGAATGG - Intergenic
1147777659 17:42914219-42914241 CCACTGCGCTTGGCCAGAAATGG + Intergenic
1147789073 17:43001802-43001824 CCACTGTGCCCGGCCAAATTAGG - Intronic
1147814330 17:43197862-43197884 CCACTGTGCCCGGCCTATAAAGG - Intronic
1147987094 17:44312868-44312890 CTTCTGTGCATGGCCCAGAATGG - Intronic
1148121000 17:45211171-45211193 CCACTGTGCCTGGCCTAGAATGG + Intergenic
1148417668 17:47519908-47519930 CCACTGTGTCTGCCCTAAAATGG - Intergenic
1148471897 17:47899472-47899494 CCACTGTGCCTAGCCAACATGGG + Intronic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148507386 17:48138655-48138677 CCACTGCGCCTGGCCACAACTGG + Intronic
1148721232 17:49754749-49754771 CCACTGCACCTGGCCGAAAACGG - Intronic
1148849065 17:50545746-50545768 CCACCGTGCCTGGCCAGAGAAGG - Intronic
1149505430 17:57190062-57190084 CCACTGTGCCTGGCCAATTATGG + Intergenic
1149707256 17:58706139-58706161 CCACCGTGCCTGGCCAGCAAAGG - Intronic
1149749993 17:59136449-59136471 CCACTGTGCCTGGCCAGTACTGG + Intronic
1149769935 17:59312543-59312565 CCACTGCGCCTGGCCTAAAATGG + Intergenic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1150503640 17:65676049-65676071 CCACTGCGCCTGGCCTTAAATGG - Intronic
1150931303 17:69588316-69588338 CCACTGTGCCCGGCCATAAGTGG + Intergenic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1151477033 17:74350084-74350106 CTACTGTGCCTGGCCACAGACGG + Intronic
1151524071 17:74651767-74651789 CCACTGTGCCTGGCCAGTAATGG + Intergenic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151896632 17:76985166-76985188 CCACTGAGCCTGGCCAAGGAAGG + Intergenic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1151953490 17:77368597-77368619 CCATGGTGGCTGGCCAAAAATGG + Intronic
1152303994 17:79510783-79510805 CCACTGTGCCTGGCCAGCAAGGG - Intronic
1152585880 17:81189259-81189281 CTCCTGCGCCTGGCCAGGAACGG + Intergenic
1152874550 17:82779289-82779311 CCACTGCGCCTGGCCAAGATGGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153143870 18:2006476-2006498 CTACTGTGCCTGGCCTAGTATGG - Intergenic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153299342 18:3579495-3579517 CTACTGTGCCTGGCCACGCCTGG + Intronic
1153302223 18:3601371-3601393 CCACTGCGCCTGGCCCAGAATGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1154174045 18:12071765-12071787 CCACCGTGCCTGGCCACAAAAGG - Intergenic
1154179364 18:12118318-12118340 CCACCGTGCCCGGCCTAAAAAGG - Intronic
1154948479 18:21185148-21185170 CTGCTGTGCCTGGCCTGAAAAGG - Intergenic
1155278979 18:24218731-24218753 CCACTGCGCCTGGCCCAACATGG + Intronic
1155279732 18:24227178-24227200 CCACTGCGCCTGGCCAGAAACGG + Intronic
1155305676 18:24475718-24475740 CTACCGCACCTGGCCCAAAAAGG - Intronic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156356421 18:36346076-36346098 CCACTGTGCCCAGCCAAAATTGG - Intronic
1156385252 18:36598834-36598856 CCACCGCGCCTGGCCAAAGAAGG + Intronic
1156466794 18:37352932-37352954 CTACCGCGCCCGGCCAAGAAAGG - Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1156683469 18:39617990-39618012 CCACTGCACCTGGCCGAAAATGG + Intergenic
1156718570 18:40042153-40042175 GTGCTGTGCCTGTCCAAAAAAGG + Intergenic
1157329727 18:46694869-46694891 CCACTGCGCCCGGCCTAAAAAGG - Intronic
1157373374 18:47139169-47139191 CCACCGTGCCCGGCCAACAAAGG - Intronic
1157835102 18:50894274-50894296 CCACCGCGCCCGGCCAAAAAGGG - Intronic
1158465542 18:57686704-57686726 CCACTGTGCCCGGCCAGAGATGG + Intronic
1158468238 18:57710920-57710942 CCACTGTACCTGGCCTCAAATGG + Intronic
1158631522 18:59119167-59119189 CCACTGTGCCTGGCCAGCGATGG + Intergenic
1159966504 18:74600447-74600469 CTACAGTGGCTTGGCAAAAAAGG - Intronic
1161147677 19:2688776-2688798 CCACTGTGCCCGGCTAACAATGG - Intronic
1161225608 19:3143831-3143853 CCACTGCGCCTGGCCAAGAGAGG - Intronic
1161259727 19:3330955-3330977 CCACTGTGCCCGGCCAAGATGGG - Intergenic
1161751756 19:6102835-6102857 CCACTGTGCCTGGCCATAAGAGG - Intronic
1161899668 19:7109192-7109214 CCACTGTGCCCGGCCAAAAGTGG + Intergenic
1161942211 19:7412453-7412475 CCACCGTTCCTGGCCTAAAATGG - Intronic
1162136919 19:8561169-8561191 CCACTGTGCCTGGCCTGAGAAGG + Intronic
1162164183 19:8741004-8741026 CTACTGTGCCCGGCCAGAGATGG + Intergenic
1162165255 19:8748473-8748495 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162166320 19:8755927-8755949 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162167386 19:8763383-8763405 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162168327 19:8769683-8769705 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162169393 19:8777136-8777158 CTACTGTGCCCGGCCAGAGATGG + Intergenic
1162170074 19:8782448-8782470 CTACTGTGCCCGGCCAGAAATGG + Intergenic
1162171155 19:8790101-8790123 CTACTGTGCGTGGCCAGAAATGG + Intergenic
1162245464 19:9396332-9396354 CCACTGTGCCTGGCGATAAAGGG - Intergenic
1162330219 19:10023628-10023650 CCACTGCGCCCAGCCAAAAATGG + Intergenic
1162540356 19:11291993-11292015 CCACTGTGCCTGGCCTGACAGGG + Intergenic
1162733314 19:12731833-12731855 CCACCGCGCCTGGTCAAAAAGGG - Intronic
1163037846 19:14581617-14581639 CCACCGCGCCTGGCCAGAAATGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1163431607 19:17271275-17271297 CCACTGTGCCAGGCCAAATAAGG + Intronic
1163911861 19:20202800-20202822 CCACTGTGCCCAGCCAATAAAGG - Intergenic
1163983190 19:20921126-20921148 CCACCGTGCCTGGCCTAATATGG - Intergenic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164396551 19:27869021-27869043 CCACTGTGCCCAGCCAATAATGG + Intergenic
1164587935 19:29488805-29488827 CTACTGTGCCCGGCCACTAGTGG - Intergenic
1164795656 19:31025528-31025550 CCACCGTGCCTGGCCACAGATGG + Intergenic
1164845911 19:31432441-31432463 CTACTCTGCCTGGACACAACAGG + Intergenic
1165026832 19:32968533-32968555 CCACTGCACCTGGCCAGAAAAGG + Intronic
1165029976 19:32991032-32991054 CCACTGTGCCTGGCCAATTTTGG - Intronic
1165084238 19:33331952-33331974 CCACTGTGCCTGGCCATGAATGG + Intergenic
1165502854 19:36203864-36203886 CTACTGTGCCTGGCCTAACAAGG + Intronic
1165507465 19:36243319-36243341 CCACTGTGCCAGGCCCAAACTGG + Intronic
1165653267 19:37510071-37510093 CCACTGTGCCTGGCCAAACAAGG - Intronic
1165775974 19:38404493-38404515 CCACTGTGCCTGGGCAAAGGTGG + Intronic
1165791912 19:38497684-38497706 CCACTTTGCCTGGCCAGACAGGG - Intronic
1165889098 19:39100019-39100041 CCACTGTGCCGGGCCAAGATGGG - Intronic
1165954058 19:39490675-39490697 CTACTGTGCCCAGCTAAAATAGG + Exonic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166149477 19:40861793-40861815 CCACTGTGCCTGGCCAATGGAGG - Intronic
1166386638 19:42385999-42386021 CCACCGCGCCTGGCCTAAAAAGG - Intergenic
1166534281 19:43562454-43562476 CCACTGCGCCTGGCCAAGGAGGG - Intronic
1166549005 19:43652571-43652593 GCACGGTGCCTGGCCAGAAATGG - Intronic
1166819484 19:45568736-45568758 CTCCTGAGCCTGGCCAATTAGGG + Intronic
1167024868 19:46908077-46908099 CAAATGTGCCTTGCCAACAAAGG - Intergenic
1167044547 19:47042018-47042040 CCACTGTGCCTGGCCTAGAAGGG - Intronic
1167540366 19:50082750-50082772 CCACTGCGCCTGGCCCAAAACGG - Intergenic
1167629342 19:50615049-50615071 CCACTGCGCCTGGCCCGAAACGG + Intergenic
1167629752 19:50618284-50618306 TCACTGTGCCTGGCCCATAATGG + Intergenic
1167801912 19:51748746-51748768 CCACTGTGCCCAGCCTAAAATGG + Intronic
1167899616 19:52609777-52609799 CCACTGTGCCTGGTCCAAAAAGG - Intronic
1168173833 19:54608578-54608600 CCACTGTGCCTGGCCGAAGATGG - Intronic
1168219629 19:54951257-54951279 CCACTGTGCCTGGTCTACAAAGG - Intronic
1168245143 19:55109383-55109405 CCACTGTGCCAGGCCTCAAATGG + Intronic
1168478419 19:56695573-56695595 CTACCGTGCCCTGCCAAAATGGG - Intergenic
924961405 2:37911-37933 CCACTGTGCCCGGCCAAGATGGG - Intergenic
925440850 2:3883863-3883885 CCACTATACCTGGCCAAGAAAGG - Intergenic
925668719 2:6289596-6289618 CCACTGTGCCAGGCCAAGATTGG - Intergenic
925898664 2:8493130-8493152 CCACTGCGCCTGGCCCGAAAGGG + Intergenic
926035855 2:9635101-9635123 CCACTGTGCCTGGCCTAAATCGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926187554 2:10703014-10703036 CCACCGTGCCTGGCCCGAAAAGG + Intergenic
926243960 2:11108360-11108382 CTACCGCGCCTGGCCAATAAAGG - Intergenic
926246545 2:11125806-11125828 CCACTGTGCCTGGCCATACAAGG + Intergenic
926684323 2:15687106-15687128 CCACTGTGCCTGGCCCCAAGTGG - Intergenic
926927976 2:18007472-18007494 CCACTGCGCCTGGCCAACAGTGG - Intronic
927556247 2:24034860-24034882 CCACTGTGCCTGGCCAAACATGG + Intronic
927592903 2:24372194-24372216 CTCCTGGGCCTGGCCAAGCAAGG - Intergenic
927675659 2:25104058-25104080 CCACTGTGCCTGGCCACCACGGG - Intronic
927968447 2:27287492-27287514 CCACTGTTCCTGACCGAAAAGGG + Intronic
927977496 2:27349925-27349947 CCACTGTGCCCAGCCCAAAAGGG + Intronic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928567550 2:32568555-32568577 CCACTGCGCCCAGCCAAAAAAGG - Intronic
929057126 2:37887948-37887970 CCACTGTGCCCAGCCAGAAATGG + Intergenic
929258555 2:39839572-39839594 CCACTGTGCCTTGCCAAATAAGG - Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930813905 2:55571905-55571927 CCACTGCGCCTGGCCAACACTGG + Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
930840305 2:55837959-55837981 CTACCATGCCTGGCCTAGAATGG + Intergenic
931544273 2:63363886-63363908 ACACTGTGCCTGGCAAAAATTGG - Intronic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
932184033 2:69676605-69676627 CCACTGTGCCCGGCCAGAGATGG - Intronic
932250530 2:70239377-70239399 CCACTGCGCCCGGCCAATAAAGG + Intronic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932643074 2:73470514-73470536 CTATTGTGCTTGGGAAAAAAAGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
933715597 2:85357659-85357681 CTACTTTGCCCACCCAAAAATGG + Intronic
933739948 2:85525479-85525501 CCACTGTGCCCAGCCAAGAATGG - Intergenic
933885141 2:86712177-86712199 CCACAGTGCCTGGCCTCAAAAGG + Intronic
933925033 2:87084507-87084529 CCACAGTGCCTGGCCTCAAAAGG - Intergenic
934082023 2:88476930-88476952 CCACTGCACCTGGCCAAACATGG + Intergenic
934088122 2:88527178-88527200 CCACTGTGCCTGGCCTACAAGGG - Intronic
934544410 2:95202913-95202935 CCACCGCGCCTGGCCAGAAAAGG + Intergenic
934670731 2:96210685-96210707 CCACCGTGCCTGGCCTTAAAAGG + Intergenic
934697180 2:96408262-96408284 CCACTGTGCCTGGCCCGAAATGG + Intergenic
934852478 2:97710322-97710344 CCACCGCGCCAGGCCAAAAATGG - Intergenic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935235476 2:101134884-101134906 CCACCGTGCCCGGCCAAATATGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936074333 2:109392101-109392123 CCACTGTGCCTAGCCCAAAAAGG + Intronic
936226073 2:110653715-110653737 CCACTGTGCCTGGCCAGTAGTGG - Intronic
936240191 2:110781352-110781374 CGACTGTGCCTGGCCAAGTCTGG - Intronic
936586111 2:113759419-113759441 CGACTGCGCCTGGCCCACAAGGG - Intergenic
937001999 2:118476372-118476394 CTACTTTTCTTGGCCAAAAATGG + Intergenic
937073514 2:119083819-119083841 CCACTGTGCCTGGCCAGATGTGG - Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937406944 2:121638954-121638976 CCACTGTGCCCAGCCAACAATGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937598506 2:123699550-123699572 CCACCGTGCCTGGCCAAATGTGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
938007875 2:127803290-127803312 CCACTGTGCCTGGCCTACATTGG - Intronic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938904914 2:135828308-135828330 CCACTGTGCCTAGCCAAACTTGG + Intronic
938939164 2:136153987-136154009 CCACTGTGCCCGGCCAGGAATGG - Intergenic
938953417 2:136278033-136278055 CTTCTGTTCCTGGGCAATAAGGG + Intergenic
939438018 2:142203796-142203818 CCACTGCGCCTGGCCCAAAAAGG - Intergenic
939510637 2:143100274-143100296 TTACTGTGCCTGCTCACAAAGGG + Intronic
940129275 2:150362884-150362906 CTACCGTGCCCGGCCAAAAGGGG - Intergenic
940921502 2:159312759-159312781 CCACTGCACCTGGCCAAAAAAGG + Intergenic
940997373 2:160164402-160164424 CCACTGTGCCCAGCCTAAAATGG - Intronic
941212570 2:162659628-162659650 CCACTGCGCCTGGCCAATAGTGG + Intronic
941922439 2:170864508-170864530 CCACTGTGCCTGACCAAGAAGGG + Intergenic
941967670 2:171315412-171315434 CCACTGCGCCTGGCCGAATATGG + Intergenic
942033720 2:171990054-171990076 CCACAGTGCCTGGCCAACGAAGG + Intronic
942280291 2:174356176-174356198 CCACTGCGCCTGGCCAGGAAAGG - Intronic
943121139 2:183737642-183737664 CCACTGTGCCTGGCCACATAAGG - Intergenic
943704212 2:191017912-191017934 CCACTGTGCCTGGCCTCAACTGG + Intronic
943757265 2:191569622-191569644 CTACCGTGCCTGGCCTAGCAAGG + Intergenic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
944156087 2:196609217-196609239 CCACTGCACCTGGCCAAAACTGG - Intergenic
944233354 2:197417946-197417968 CCACTGTGCCTGGCCATTACAGG - Intronic
944553858 2:200869076-200869098 CCACTGTGCCTGGCCCATCAAGG + Intergenic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945261814 2:207850865-207850887 CCACTGTGCCTGGCCAGGAAGGG - Intronic
946768381 2:223061483-223061505 CTACTGTGCCTGGCCGTGATAGG + Intronic
946864029 2:224026734-224026756 CTTATGTGCCTGGCCCAGAAGGG + Intronic
947049148 2:226022592-226022614 CCACTGTGTCTGGCCTTAAATGG - Intergenic
947090367 2:226503509-226503531 CCACTGCGCCCGGCCGAAAAGGG + Intergenic
947151438 2:227120648-227120670 CCACTGTGCCTGGCCAGCACTGG - Intronic
947434207 2:230058918-230058940 TCACCGTGCCTGGCCTAAAATGG + Intronic
947697160 2:232201060-232201082 CCACCGTGCCTGGCCCCAAAAGG + Intronic
947746791 2:232512088-232512110 CTCCTGTCCTTGGCCTAAAACGG + Intergenic
947842849 2:233219545-233219567 CCACTATGCCTGGCCCAAGATGG - Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948225238 2:236304694-236304716 CCACTGCGCCCGGCCAGAAATGG + Intergenic
948439114 2:237974934-237974956 CCACTGTGCCCGGCCATAAATGG + Intronic
948545625 2:238726698-238726720 CCACTATGCCTGGCCTAGAATGG + Intergenic
1168775804 20:446626-446648 CCACTGTGCCCGGACAAAAGAGG + Intronic
1169126433 20:3130942-3130964 CCACTGCGCCTGGCCCAAAGAGG - Intronic
1169385220 20:5143129-5143151 CTACCATGCCCAGCCAAAAATGG + Intronic
1169407232 20:5331972-5331994 CCACTGCACCTGGCTAAAAAAGG + Intergenic
1169460827 20:5793414-5793436 CCACTGTGCCTGGCCTAATGTGG - Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169770445 20:9194397-9194419 CCACTGCGCCCGGCCCAAAAAGG - Intronic
1169918679 20:10709630-10709652 CCACTGTGCCTAGCCCAAAGAGG + Intergenic
1169925052 20:10774276-10774298 CTCCTGTGCCTGGCCATATATGG - Intergenic
1170514125 20:17110341-17110363 CCACTGTGCCTGGCCATGAATGG - Intergenic
1170699173 20:18687809-18687831 CCACTGTGCCTAGCCAAAATAGG + Intronic
1170847296 20:19973499-19973521 CCACTGTGCCTGGCCTGGAATGG - Intronic
1171528803 20:25837650-25837672 CCACTGTGCCCGGCCAATAGAGG - Intronic
1171548023 20:26018236-26018258 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1171871750 20:30532902-30532924 CTACTGTGCCCGGCCTGAATAGG + Intergenic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1172527102 20:35606469-35606491 CCACTGTGCCCAGCCAAGAATGG - Intergenic
1172691137 20:36790860-36790882 CCATTGCACCTGGCCAAAAAAGG + Intronic
1172785751 20:37467479-37467501 GCACTGTGCCTGGCCAGAAAGGG - Intergenic
1172832086 20:37844621-37844643 CCATTGTGTCTGGCCCAAAAGGG - Intronic
1172849577 20:37951180-37951202 CCACTGCGCCAGGCCTAAAATGG + Intergenic
1172864752 20:38087245-38087267 CCACTGCGCCTGGCCACAACTGG + Intronic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173299633 20:41790360-41790382 CTACCATGCCTGGCCATCAATGG + Intergenic
1173412862 20:42829438-42829460 CCACTGCGCCTGGCCAATCATGG - Intronic
1173577856 20:44124524-44124546 CCACTGTGCCTGACCATACAAGG - Intronic
1174007411 20:47421439-47421461 CCACTGTGCCTGGCCACAAATGG + Intergenic
1174010397 20:47444942-47444964 CCACTGTGCCTGGCCTAGGATGG + Intergenic
1174243578 20:49158520-49158542 CCACTGCACCTGGCCAATAAAGG - Intronic
1174251765 20:49225326-49225348 CCACTGTGCCTGGCCAGTAGTGG + Intronic
1174256285 20:49257997-49258019 CCACCGTGCCTGGCCAGAGATGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174393505 20:50232553-50232575 CCACTGTGCCTGGCCATCATTGG + Intergenic
1174661209 20:52214906-52214928 CCACTGCGCCTGGCCTTAAAAGG + Intergenic
1175002559 20:55645010-55645032 CTTCAGTGCCTGGCCCAGAATGG - Intergenic
1175244183 20:57571671-57571693 CCACCGTGCCCGGCCAGAAATGG + Intergenic
1175559397 20:59907957-59907979 CCACCGTGCCTGGCCAGGAATGG - Intronic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1177127650 21:17216406-17216428 ATACTTGGCCTGACCAAAAAGGG - Intergenic
1177156377 21:17505521-17505543 CCACAGTGCCTGGCCTAAGAGGG - Intergenic
1177799576 21:25814840-25814862 CCACTGTGCCCAGCCAAAGAAGG + Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178927726 21:36790116-36790138 CCACTGCGCCAGGCCCAAAACGG - Intronic
1179219725 21:39395649-39395671 CCACTGTGCCTGGCCAGGAATGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1180213302 21:46309029-46309051 CCACTGCGCCTGGCCAAATCTGG - Intronic
1180691159 22:17717178-17717200 CCACTGTGCCTGGCCAAAGTTGG - Intronic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180892452 22:19299730-19299752 CCACTGTGCCCAGCCAATAAAGG - Intergenic
1180971304 22:19817199-19817221 CCACTGTGCCTGGCCCCTAATGG - Intronic
1181291582 22:21798429-21798451 CCACTGTGCCTGGCCACATCTGG - Intronic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181557466 22:23679628-23679650 CCACCGTGCCTGGCCACAAATGG - Intergenic
1181579826 22:23821988-23822010 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1181613769 22:24037581-24037603 CCACTGTGCCTGGCCTGCAATGG + Intronic
1181660507 22:24343729-24343751 CCACTGTGCCCAGCCCAAAATGG + Intronic
1181780792 22:25191441-25191463 CCACTGTGCCCGGCCAGAAATGG + Intronic
1181786413 22:25230441-25230463 CCACTGTGCCTGGCCTGGAACGG + Intronic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1182199980 22:28558741-28558763 CCACTGTGCCCGGCCAGAAATGG - Intronic
1182348752 22:29686350-29686372 CCACTGTGCCCGGCCAATTATGG - Intronic
1182414764 22:30214167-30214189 CCACTGCACCTGGCCAGAAATGG - Intergenic
1182861299 22:33561660-33561682 CTCCTGACCCTGGCCAATAATGG + Intronic
1183421189 22:37712620-37712642 CCACTGCGCCCGGCCTAAAATGG + Intronic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183523122 22:38307975-38307997 CCACTGTGCCTGGCCCAGGAGGG + Intronic
1183680086 22:39323248-39323270 CCACTGTGCCTAGCCAACATAGG - Intergenic
1183720638 22:39559709-39559731 CTGCTGTGCCTGCCCCACAATGG + Intergenic
1183821637 22:40350915-40350937 CCACTGTGCCTGGCCTTCAAAGG + Intronic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1183920506 22:41163460-41163482 CCACTGTGCCCGGCCAAACCTGG - Intronic
1183946297 22:41327834-41327856 CCACTGTGTCTGGCCAAGAAAGG - Intronic
1183971057 22:41477777-41477799 CCACTGTGCCCGGCCACAACTGG - Intronic
1184053270 22:42025078-42025100 CAACTGTGCCCAGGCAAAAATGG + Intronic
1184063597 22:42101834-42101856 CCACTGTGCCTGGCCCATTAAGG + Intergenic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1184847245 22:47096532-47096554 CCACCGTGCCCGGCCAACAAAGG - Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
1184984940 22:48124785-48124807 CTACTGTGCCTGGCCGGAGTAGG + Intergenic
949109219 3:238635-238657 CCACTGTACCTGGCCAGAAAAGG - Intronic
949119139 3:364496-364518 ATACAGTGCTTGGCCCAAAATGG + Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949584117 3:5421264-5421286 CCACCGTGCCCGGCCAAGAAAGG - Intergenic
949973733 3:9434955-9434977 CCACTGCGCCTGGCCAAGAGGGG - Intronic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950066839 3:10118773-10118795 CCACTGTGCCTGGCCATAAGTGG + Intronic
950174774 3:10865374-10865396 CCACTGTGCCTGGCCACCACAGG - Intronic
950651464 3:14409898-14409920 CCAGTGTGCCTGGCCAACAATGG - Intronic
951809656 3:26685238-26685260 GTACTGTGCCTGGCCCACATGGG + Intronic
951902433 3:27670080-27670102 CCACTGTGCCCGGCCGAAAGTGG - Intergenic
952388352 3:32859543-32859565 CCACTGTGCCTGGCCAACTTTGG + Intronic
952483298 3:33784625-33784647 CCACTGTACCTGGCCTAACATGG - Intergenic
952591562 3:34961548-34961570 CTGCTGTAACTGGCCAATAAAGG - Intergenic
952796777 3:37246061-37246083 CCACGGTGCCAGGCCAGAAATGG - Intronic
952911152 3:38187871-38187893 CCACTGTACCTGGCCTATAAAGG + Intronic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953476346 3:43209027-43209049 CTACCGCACCTGGCCAAAATGGG - Intergenic
954051442 3:47981995-47982017 CCACTGTGCCCGGCCAACATAGG - Intronic
954071801 3:48148437-48148459 CTACCATGCCCGGCCAAGAAAGG - Intergenic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954246287 3:49334467-49334489 CCACTGTGCCTGGCCTAACTTGG - Intronic
954308637 3:49746707-49746729 CCACTGTGCCCGGCCAAGAATGG + Intronic
954579272 3:51694416-51694438 CCACCGCGCCTGGCCAAAGAGGG + Intronic
955153568 3:56393108-56393130 CCACTGTGCCTGGCCAGGAATGG - Intronic
955273289 3:57523093-57523115 CCACTGTGCCCGGCCAATATGGG - Intronic
955291336 3:57695012-57695034 CCACTGTGCTTGGCCACAACTGG - Intergenic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955759509 3:62263723-62263745 CCACTGTGCCTGGCCTTAAATGG - Intronic
955817093 3:62855230-62855252 GCACTGTGCTTGGCCTAAAATGG + Intronic
956117182 3:65930442-65930464 CCACCGTGCCTGGCCACAAGTGG - Intronic
956127538 3:66025249-66025271 CCACTGTGCCTGGCCAATCATGG - Intronic
956144498 3:66178472-66178494 CTACTGAGCTTGGACAACAAGGG - Intronic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956810568 3:72860419-72860441 CCACTGCGCCCGGCCAGAAACGG - Intronic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
957871089 3:86091282-86091304 CCACTGCGCCTGGCCAGCAAGGG - Intergenic
958733142 3:97979768-97979790 CTGCTGTGCCTGGCCAGGGATGG + Intergenic
959059236 3:101601075-101601097 TCACTGTGCCTGGTCAGAAATGG + Intergenic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959914134 3:111796798-111796820 CCACTGTGCCTGGCCCAAGAGGG + Intronic
960069039 3:113408575-113408597 CCACTGTGCCCAGCCAAATAAGG - Intronic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960207955 3:114925811-114925833 CCACTGTGCCTGGCCAATTATGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
960802099 3:121550199-121550221 CCACTGTGCCTGGCCTAATTTGG - Intergenic
960907017 3:122611624-122611646 CTACTGTGCCTGGCCTTAAGAGG + Intronic
961190670 3:124958548-124958570 CCACTGATCCTGGCAAAAAAAGG - Intergenic
961255245 3:125544341-125544363 CTACTGCACCTGGCCAAGAATGG + Intronic
961736741 3:129006601-129006623 CCACTGTGCCCGGCCAAAAGTGG + Intronic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962246180 3:133795861-133795883 CCACTGCACCTGGCCAAAAAGGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962392828 3:134987470-134987492 CCACTGTGCCTGGCCTCACATGG - Intronic
962496691 3:135946981-135947003 CCACTGTGCCTGGCCAATGAAGG - Intergenic
962519736 3:136187373-136187395 CCACTGCGCCTGGCCAAATATGG - Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963829860 3:149994629-149994651 CCACCGTGCCCAGCCAAAAAAGG + Intronic
963838651 3:150082241-150082263 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
964787560 3:160415082-160415104 CCATTGTGCCTGGCCAACATTGG - Intronic
965010189 3:163077766-163077788 CCACCGTGCCCGGCCAAAATGGG + Intergenic
965069009 3:163892519-163892541 CCACTGTGCCTGGCCATAAATGG + Intergenic
966119320 3:176504616-176504638 CCACTGTGCCTGGTCTCAAAAGG + Intergenic
966555723 3:181258177-181258199 CCACTGTTCCTTGCCTAAAATGG - Intergenic
966688965 3:182724606-182724628 CCACTGCGCCCGGCCAGAAAGGG - Intergenic
966812989 3:183865016-183865038 CCACTGTGCCTGGCCCCAAGAGG - Intronic
966843981 3:184112152-184112174 CTACTGTGCCCGGCCTGACATGG + Intergenic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
967245545 3:187483067-187483089 CCACTGTGCCCAGCCACAAATGG - Intergenic
967479280 3:189955689-189955711 CTACTGTGCCCGGCCGTGAATGG - Intergenic
967914226 3:194566311-194566333 CCACTGTACCTGGCCAGAATGGG - Intergenic
968013891 3:195309252-195309274 CCACCGTGCCTGGCCACAAGTGG - Intronic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968617761 4:1587382-1587404 CCACTGTGCCCGGCCAGAAAGGG - Intergenic
968667668 4:1829525-1829547 CCACTGTTCCTGGCCAAGAACGG - Intronic
968807050 4:2780903-2780925 CCACTGCACCCGGCCAAAAAAGG - Intergenic
968837850 4:2978803-2978825 CCACTGTGCCTGGCCACACATGG - Intronic
969233021 4:5845036-5845058 GTGCTATGCCTGGCCAAAGATGG + Intronic
969585560 4:8089445-8089467 CCACTGCGCCTGGCCACACAGGG - Intronic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
970158887 4:13169402-13169424 CCACTGTGCCTGGCCCCATAAGG + Intergenic
970649536 4:18161038-18161060 CCACTGTGCCCGGCCCAAAAAGG + Intergenic
970722646 4:19006011-19006033 CCACTGTGCCTGGCCTGTAAAGG + Intergenic
970938675 4:21605765-21605787 CCACTGTGCCTGGCGTACAATGG + Intronic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
971397637 4:26243805-26243827 CCACTGTGCCTGGCCAAGGGAGG - Intronic
972044784 4:34652137-34652159 CCACCGTGCCTGGCCAAATTTGG + Intergenic
972284249 4:37633119-37633141 CCACCGTGCCTGGCCAAACATGG - Intronic
972431446 4:38986519-38986541 CCACCGTGCCTGGCCATGAATGG - Intronic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972614751 4:40687306-40687328 CCACTGTGCCTGGCCAGAGTTGG - Intergenic
973167485 4:47095410-47095432 GTACTGTCCCTGGCAAATAATGG + Intronic
973323897 4:48837576-48837598 CCACTGTGCCTGGCCAGAATGGG + Intronic
973812111 4:54581571-54581593 CCACCGTGCCTGGCCATGAAAGG - Intergenic
973946448 4:55961475-55961497 CCACCGTGCCCGGCCAAAGATGG - Intronic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
974462447 4:62205395-62205417 CCACTGTGCCCAGCCAGAAAAGG + Intergenic
974901769 4:68008352-68008374 CCACTGTGCCCGGCCAAAAGAGG - Intergenic
975247272 4:72133975-72133997 CCACTCTGCCTGGCCAAGGATGG - Intronic
975282866 4:72583066-72583088 CAACTGTGCCAGGCAAAGAATGG - Intergenic
975873817 4:78812254-78812276 CCACTGTGCCTGGCCTTTAATGG + Intronic
976419976 4:84830899-84830921 CCACTGCGCCTGGCCAACAATGG - Intronic
976800785 4:88989312-88989334 CCACTGTGCCTGGCCAACTCAGG - Intronic
977252532 4:94704811-94704833 CCGCTGTGCCTGGCCCAATAAGG - Intergenic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
978032495 4:103952465-103952487 CTACTGTGCCTGTCAGAAAGTGG - Intergenic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978506626 4:109464505-109464527 CTACTGTGCCTGGCCCAATGTGG + Intronic
978535152 4:109754267-109754289 CTACTGTGCCTGGCCTCCCAAGG + Intronic
978854248 4:113375436-113375458 CCACTGTGCCTGGCCAACCGTGG - Intronic
979575193 4:122282352-122282374 CCACTGCGCCCGGCCAAAGAAGG - Intronic
979683375 4:123485214-123485236 CCACTGTGCCTGGCCAATTTGGG - Intergenic
979916140 4:126436583-126436605 CCACTGCGCCTGGCCAATATGGG - Intergenic
980135643 4:128856104-128856126 CCACTGTGCCTGGTCAAGCATGG + Intronic
980936005 4:139226567-139226589 CCACTGCACCTGGCCAAAATTGG - Intergenic
980948083 4:139342733-139342755 CCACTGCGCCTGGCCTAATATGG + Intronic
980957010 4:139439285-139439307 CCACTGTGCCTGGCCAGATATGG + Intergenic
981012272 4:139937673-139937695 CCACTGCGCCTGGCCAGCAAAGG + Intronic
981151512 4:141384377-141384399 CCACTGTGCCTGGCCAACTGTGG - Intergenic
981284393 4:142998296-142998318 GCACTGTGCTTGGCCAAAAAAGG + Intergenic
981327070 4:143461965-143461987 CCACTGTGCCTGGCTAAATTTGG - Intronic
981340493 4:143616497-143616519 CCACTGCGCCCGGCCAAAAGTGG - Intronic
981511654 4:145565030-145565052 CCACTATGCCTGGCCAAATTTGG - Intergenic
981703606 4:147635007-147635029 CCACTGCGCCTGGCCAAGAATGG + Exonic
981982352 4:150809565-150809587 CCACTGCACCTGGCCAAAAATGG - Intronic
982051424 4:151506193-151506215 CCACTGTGCCTGGCCTAAATGGG + Intronic
982055898 4:151548632-151548654 CCACTGTGCCTGGCCATATAGGG - Intronic
982125730 4:152182403-152182425 CCACTGTGCCTGGCCAACTCTGG + Intergenic
982224704 4:153154850-153154872 CCACTGTGCCTGGCCAATTTGGG - Intronic
982229564 4:153196095-153196117 CCACTGTGCCTGGCCAGAAAAGG + Intronic
982751322 4:159165878-159165900 CCACTGTGCCTAGCTAACAATGG + Intronic
982920506 4:161267816-161267838 CCACCGTGCCCGGCCGAAAATGG + Intergenic
983606880 4:169597316-169597338 TGTCTGTGCCTGGCCAGAAATGG + Intronic
983653628 4:170057650-170057672 CCACTGCGCCTGGCCAACTATGG + Intergenic
984165935 4:176303331-176303353 CTATTCTGCCTTGCCAAGAATGG - Intergenic
984707629 4:182859375-182859397 CCACTGCGCCTGGCCAGAAAAGG - Intergenic
984901638 4:184591487-184591509 CCACTGTGCCTGGCCCTACAGGG - Intergenic
985199088 4:187465658-187465680 CCACTGTGCCTAGACAAAGAGGG - Intergenic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
986352749 5:6895579-6895601 CTACTGTGCCTGGCCAAATTAGG + Intergenic
986363197 5:7002210-7002232 CCACTGTGCCCGGCCAATAAAGG - Intergenic
986681847 5:10240706-10240728 CCACTGCGCCTGGCCATAAATGG - Intronic
986993949 5:13585093-13585115 CCACTGTGCCTGGCCACCTAGGG - Intergenic
987139459 5:14930370-14930392 CTACCGGGCCCGGCCAAAATAGG + Intergenic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
989173901 5:38501464-38501486 CCACTGTGCCCGGCCGAAATAGG - Intronic
989437651 5:41433583-41433605 CTCCTGTGCCTGAGCAAACATGG - Intronic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990334441 5:54758162-54758184 CTTCTGTGCCTGGCACAAGATGG + Intergenic
990460960 5:56030451-56030473 CCACTGCGCCTGGCCAGAGATGG - Intergenic
990909500 5:60839528-60839550 CAACTGTGCATGGTCAAAACTGG + Intronic
991113567 5:62928502-62928524 CTACTGAGCCTGCCCACAATGGG - Intergenic
991465365 5:66906833-66906855 TTACTGTGCCTAACCAAGAAAGG - Intronic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
991716476 5:69455338-69455360 CCACCGTGCCTGGCCTCAAATGG + Intergenic
991938590 5:71828044-71828066 CTACTGTACCTGTCCAACACTGG - Intergenic
992060662 5:73043217-73043239 CCACTGTTCCTGGCCAACAAAGG + Intronic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992471204 5:77056513-77056535 CCACTGTGCCCGGCCAAGAGTGG + Intronic
992561149 5:77954199-77954221 CCACTGTGCCCGGCCTATAAAGG + Intergenic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
992938472 5:81737493-81737515 CCACCGCGCCTGGCCAAACAGGG - Intronic
993583036 5:89687026-89687048 CTACTGGTCCTGCACAAAAAGGG + Intergenic
993638814 5:90377922-90377944 CTACCATGCCTGGCCAAGTACGG + Intergenic
993710893 5:91223684-91223706 CTACTGTGCCTGGCCACATCAGG + Intergenic
994676529 5:102829659-102829681 CCACTGCGCCTGGCCGCAAATGG + Intronic
994839599 5:104905736-104905758 CCACCGTGCCTGGCCAGGAAAGG + Intergenic
995192897 5:109338350-109338372 CCACCGTGCCTGGCCTGAAATGG - Intronic
996721150 5:126631367-126631389 CCACTGTGCCAGGCCAGAAGGGG + Intergenic
996758175 5:126957045-126957067 CCACTGTGCCCGGCTAAGAATGG + Intronic
997155744 5:131554802-131554824 CCACTGTGCCTGGCCTAAGTAGG + Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
997504111 5:134402388-134402410 CCACTGTGCCCAGCCCAAAAAGG + Exonic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
997894184 5:137701333-137701355 CCACCGTGCCCGGCCAAAATTGG + Intronic
997945336 5:138195306-138195328 CCACTGCGCCTGGCCCATAAAGG - Intronic
998110002 5:139493983-139494005 CCACCGTGCCTGGCCTCAAAAGG - Intergenic
998458625 5:142293188-142293210 CCACTGTGCCCGGCCAGAAAGGG - Intergenic
998588533 5:143453498-143453520 CCACTGTGCCTGGCCAGGGAAGG + Intergenic
998944170 5:147319427-147319449 CCACTGTGCCTGGCCACAATGGG + Intronic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999402300 5:151274560-151274582 CCACTGTGCCTGGCCTCCAATGG + Intergenic
999453333 5:151694746-151694768 CTACCGTGTCTGGCCCACAAAGG + Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1000011331 5:157236084-157236106 CCACCGTGCCTGGCCTTAAAAGG - Intronic
1000120026 5:158188532-158188554 CCACTGTGCCTGTCCAGAAAAGG + Intergenic
1000183668 5:158838156-158838178 CCACTGCGCCTGGCCAGGAATGG - Intronic
1000622370 5:163500603-163500625 CCACTGCGCCTGGCCAGAATAGG + Intergenic
1001111734 5:168902175-168902197 CCACTGTGCCTGGCCTGAAATGG + Intronic
1001482652 5:172099251-172099273 CCACTGTGCCGGGCCATAACGGG - Intronic
1001608351 5:172980316-172980338 CTACTGCACCTGGCCAGAAGTGG + Intergenic
1001636946 5:173217109-173217131 CCACCGTGCCTGGCCAACCATGG + Intergenic
1002109424 5:176898268-176898290 CTAATGTGCCTTTCCAAAATTGG + Intronic
1002143176 5:177157408-177157430 CCACTGCGCCTGGCCAAAGAGGG - Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002515079 5:179751722-179751744 CTACTGTGCCTGGCCATAATCGG - Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1003046594 6:2739164-2739186 CCACTGTGCCTGGCCGAAGTTGG - Intronic
1003145724 6:3508720-3508742 CCACTGTGCCTGGCCACATTTGG + Intergenic
1003152138 6:3561837-3561859 CTACTGTGCTGGGCTGAAAAGGG - Intergenic
1003187589 6:3846006-3846028 CCACTGCGCCTGGCCTGAAAGGG + Intergenic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1003546272 6:7061609-7061631 CCACCGTGCCCGGCCTAAAATGG + Intergenic
1003550093 6:7095440-7095462 CCACTGCGCCCGGCCAACAATGG - Intergenic
1003550342 6:7097665-7097687 CCACTGCGCCTGGCCAAGAAAGG - Intergenic
1003917363 6:10799758-10799780 CCACTGTGCCTGGCCAGAGACGG - Intronic
1004101466 6:12616491-12616513 CTACCGTGCCAGGCCCATAAAGG + Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004371173 6:15053740-15053762 CCGCCGTGCCTGGCCAAGAATGG - Intergenic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004396887 6:15253348-15253370 CCACCGTGCCTGGCCAAATAAGG + Intronic
1004601137 6:17150941-17150963 CCACAGTGCCCGGCCAAGAACGG - Intergenic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005638045 6:27769754-27769776 CCACCGCGCCTGGCCAAAAATGG - Intergenic
1005700781 6:28398628-28398650 CCACTGTGCCCGGCCTAAATCGG - Intronic
1006216351 6:32446641-32446663 CCACCGCGCCTGGCCAAAAACGG - Intergenic
1006537413 6:34710913-34710935 CCAGTGTGCCCGGCCAAGAATGG - Intergenic
1006559131 6:34894362-34894384 CCACTGTGCCTGGCCATGATTGG - Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1006902035 6:37509118-37509140 CCACTGCGCCTGGCCACAAATGG - Intergenic
1007118725 6:39362859-39362881 CCACTGTGCCTGGCCCTGAAGGG - Intronic
1007232618 6:40358901-40358923 CTACTGATCCTGGGCTAAAAAGG + Intergenic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007539543 6:42628432-42628454 CCACTGTGCCTGGCCAGTACTGG - Intronic
1007627000 6:43252336-43252358 CCACTGTGCCCGGCCAGAAGGGG - Intronic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1008585270 6:52943099-52943121 CCACTGCGCCAGGCCAAGAATGG + Intergenic
1008965165 6:57307523-57307545 CCACTGCGCCTGGCCAAGGATGG + Intergenic
1009460399 6:63905615-63905637 CCACCGCGCCTGGCCAAATAAGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010213595 6:73382501-73382523 CCACTGTGCCTGGCCACACCTGG + Intronic
1010240674 6:73612762-73612784 CCACTGTGCCTGGCCTAGAAAGG - Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010422786 6:75693110-75693132 CCACTGTGCCTGGCCTACAATGG - Intronic
1010604551 6:77872290-77872312 CCACTGTGCCTGGCCACAGTAGG - Intronic
1010966079 6:82210536-82210558 CCACTATGCCTGGCCAATAAAGG - Intronic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011498596 6:87963777-87963799 CCACTGCGCCCGGCCAAAAGTGG - Intergenic
1011595671 6:89013718-89013740 CCACTGTGCCCGGCTAATAATGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011662565 6:89606880-89606902 CCACTGCACCTGGCCAAAAAAGG - Intronic
1011690271 6:89860555-89860577 CCACTGTGCCTGGCCTATATTGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012449686 6:99342295-99342317 CTACTGAGCCTTGACAAAGATGG - Intronic
1012469270 6:99552753-99552775 CCACTGTGCCTGGCCAGAAATGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013244569 6:108274402-108274424 CCACTGCGCCTGGCCAAAGTGGG - Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013381548 6:109577115-109577137 CCACTGTGCCCGGCCATAGATGG + Intronic
1013545968 6:111157567-111157589 CCACCGTGCCTGGCCAAACTTGG + Intronic
1013885317 6:114958174-114958196 CCACTGTGCTTGGCCTAAATTGG - Intergenic
1013987910 6:116219000-116219022 CCACTGTGCCTGGCCACCACTGG - Intronic
1014616657 6:123609876-123609898 CTACTGTATCTAGCTAAAAAAGG + Intronic
1014686491 6:124507963-124507985 CTATTGTGCCTGGCCTAATTGGG - Intronic
1014818730 6:125961798-125961820 TTAATGTGACTGGACAAAAAGGG + Intronic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015744574 6:136496650-136496672 CTACTGCACCTGGCCTCAAATGG - Intronic
1015950720 6:138549950-138549972 CCACTGTGCCCGGCCCACAAGGG - Intronic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1015984431 6:138871516-138871538 CCACTGCGCCTGGCCAAGGATGG - Intronic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1016526076 6:145002908-145002930 CCACTGTGCCTGGCCTTAAGTGG - Intergenic
1016836051 6:148477982-148478004 TCACTGTGCCTGGCCTAAAATGG + Intronic
1017147868 6:151250891-151250913 CCACTGCGCCCGGCCAAAAATGG + Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017669634 6:156757664-156757686 CCACTGTGCCTGGCCAAGGGAGG - Intergenic
1018807045 6:167269900-167269922 CCACTGGGCCCGGCCAATAATGG + Intergenic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1019458188 7:1142930-1142952 CCACTGCGCCCGGCCAAAAAAGG + Intergenic
1019501250 7:1365817-1365839 CTACTGGGGCTGGCCAACAAGGG + Intergenic
1020060472 7:5147944-5147966 CCACTGTGCCTGGCCCCAAAAGG - Intergenic
1020095691 7:5367713-5367735 CCACCGTGCCTGGCCAACCAAGG + Intronic
1020195122 7:6031884-6031906 CTACTGCGTCTGGCCAAAAAAGG - Intronic
1020419550 7:7986223-7986245 CCACTGTGCCTGGCCACACTAGG - Intronic
1021108120 7:16662627-16662649 CCACTGTGCCAGGCTAAAAATGG - Intronic
1021314168 7:19125727-19125749 CCACTCTGCCTTGCCAGAAAAGG - Intergenic
1021408671 7:20303764-20303786 CCACTGTGCCTGGCCTTAAATGG - Intergenic
1021527914 7:21609505-21609527 CCACTGTGCCCGGCCATAACTGG + Intronic
1021605587 7:22406196-22406218 CCACTGTGCCTGGCCATGACTGG + Intergenic
1021721741 7:23511082-23511104 CCACCGCGCCTGGCCAAATAAGG - Intronic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022255055 7:28647791-28647813 CCACTATGCCTGGCCCAAATTGG - Intronic
1022483483 7:30759595-30759617 CCACTGTGCCTTGCCGAATATGG + Intronic
1022570169 7:31444868-31444890 TCACCGTGCCTGGCCAGAAATGG + Intergenic
1022598086 7:31731673-31731695 CCACTGCGCCTGGCCAGAATTGG + Intergenic
1023011056 7:35925101-35925123 CCACTGTGCCTGGCCAGAGCTGG - Intergenic
1023430643 7:40087428-40087450 CCACTGTGCCTGGCTGGAAATGG + Intronic
1024334432 7:48191693-48191715 CCACCGTGCCCGGCCAAAGAGGG + Intronic
1025077671 7:55956991-55957013 CCACTGCGACTGGCCAAAAGGGG + Intronic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025212078 7:57025579-57025601 CAACTGTGCCCGGCCCTAAATGG + Intergenic
1025621066 7:63171324-63171346 CCACTGCACCTGCCCAAAAAGGG + Intergenic
1025627916 7:63239444-63239466 CCACTGTGCTTGGCCATATAAGG - Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1025659876 7:63551249-63551271 CAACTGTGCCCGGCCCTAAATGG - Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025987955 7:66472538-66472560 CCACCGTGCCTGGCCACTAATGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026043880 7:66891640-66891662 CCACTGCGCCTGGCCTGAAATGG - Intergenic
1026248270 7:68643758-68643780 CCACTGTGCCTGGCCAGTCATGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026424857 7:70280581-70280603 CCACTGTGCCCGGCCAAATAAGG + Intronic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026761584 7:73130913-73130935 CCACTGTGCCTGGCCTTCAAGGG - Intergenic
1026921919 7:74161937-74161959 CCACTGCGCCTGGCCAGCAATGG + Intergenic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027037924 7:74939729-74939751 CCACTGTGCCTGGCCTTCAAGGG - Intergenic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027085637 7:75261746-75261768 CCACTGTGCCTGGCCTTCAAGGG + Intergenic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1027465987 7:78515611-78515633 CTACAGCGCCTGGCCAAACAAGG - Intronic
1028281492 7:88935394-88935416 CCACTATGGCTGGCCAGAAAAGG - Intronic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1028939523 7:96505389-96505411 CCACTGTGCCTGGCCTTATAAGG + Intronic
1028978743 7:96943336-96943358 GTACCGTGCCTGGCCCAAATTGG - Intergenic
1029231313 7:99071345-99071367 CCACCGCGCCCGGCCAAAAACGG + Intronic
1029312946 7:99684453-99684475 CCACTGTGCTTGGTCAAAAAAGG + Intergenic
1029320765 7:99757455-99757477 CCACTGTGCCTGATCAAAAAAGG + Intronic
1029365936 7:100116349-100116371 CCACTGTGCCTGGCCTGAGATGG - Intronic
1029522702 7:101074100-101074122 CCACTGTGCCTGGCCTAGAATGG - Intergenic
1029924098 7:104297568-104297590 CCACCGCGCCTGGCCAAAAAGGG - Intergenic
1030290706 7:107869710-107869732 CCACTGTGCCAGGCCCCAAATGG + Intergenic
1030306984 7:108028762-108028784 CCACTGTGCCCAGCCAAAAAAGG + Intronic
1030872837 7:114778448-114778470 CTATCGCGCCTGGCCAAAAATGG + Intergenic
1031071435 7:117166600-117166622 CCACTGCGCCTGGCCCATAAAGG - Intronic
1031452868 7:121943623-121943645 CCACTGCGCCCGGCCAATAATGG + Intronic
1031812115 7:126383571-126383593 CAATTGTACCTGGCCAAAAATGG - Intergenic
1031870077 7:127081601-127081623 GTACTGTGCCTGGGCCAGAAGGG + Intronic
1032563094 7:132912840-132912862 CCACTGCGCCCGGCCAAAGATGG + Intronic
1032581892 7:133111269-133111291 CCACTGCACCTGGCCTAAAATGG + Intergenic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032642558 7:133785954-133785976 CCACTGTGTCTGGCCAGAAATGG + Intronic
1032712546 7:134473369-134473391 CCACTGTGCCTGGCTAATCATGG + Intergenic
1032788475 7:135221151-135221173 CCACTGCACCTGGCCAAGAATGG - Intergenic
1033043376 7:137938629-137938651 CCACTGCCCCTGGCCAGAAATGG + Intronic
1033059859 7:138095811-138095833 CCACTGCGCCTGGCCAAATTAGG + Intronic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033178608 7:139151772-139151794 CCACTGTGCCTAGCCGGAAATGG - Intronic
1034010789 7:147527308-147527330 CAACTGTGCCCGGCCAAGACAGG + Intronic
1034164232 7:149013387-149013409 CTACTGTGCCAGCCAACAAATGG - Intronic
1034389892 7:150777791-150777813 CCACTGCGCCCGGCCAATAAAGG + Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1035349343 7:158235047-158235069 CCACCGGGCCTGGCCCAAAATGG + Intronic
1035762891 8:2082472-2082494 TTACTGTTGCTGGCTAAAAATGG + Intronic
1036433503 8:8711460-8711482 CCACTGCACCTGGCCTAAAATGG - Intergenic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037699691 8:21263273-21263295 CCACTGTGCCCGGCCAAGAAGGG - Intergenic
1037773988 8:21820644-21820666 CAACTGGCCCTGGCCAATAAAGG + Intergenic
1038164488 8:25072015-25072037 CCACTGTGCCTGGCCAAGGTGGG + Intergenic
1038172820 8:25153453-25153475 CCACTGCTCCTGGCCTAAAAAGG - Intergenic
1038656874 8:29460869-29460891 CCACTGTGCCTGGCCTCAACTGG - Intergenic
1038726377 8:30085928-30085950 CCACTGTGCCTGGCCACATCTGG - Intergenic
1039043695 8:33431257-33431279 CCACCGTGCCTGGCCAACTAGGG - Intronic
1039573973 8:38608842-38608864 CTACTGTGCCTAGCCATCCAGGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039960136 8:42239924-42239946 CCACCGTGCCTGGCCGTAAAAGG + Intergenic
1040409143 8:47137177-47137199 CCACTGCCCCTGGCCAATAAGGG + Intergenic
1040441474 8:47447499-47447521 CCACCGCGCCTGGCCAGAAACGG + Intronic
1040988200 8:53319316-53319338 CCACTGCACCTGGCCAAGAAAGG - Intergenic
1041227022 8:55711001-55711023 CCACGGTGCCTGGCCAACAGTGG - Intronic
1041496330 8:58488970-58488992 CCACTGTGCCTGGCCATCCATGG + Intergenic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042222526 8:66487401-66487423 CTACCGTGCCTGGCCACAGTGGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042299342 8:67259513-67259535 CCACTGTGCCCGGCCAACCAAGG + Intronic
1042315915 8:67425659-67425681 CCACTGTGCCAGGCCAGAGATGG + Intronic
1042674072 8:71299195-71299217 GTACTGACCCTGGCCAAAACTGG + Exonic
1042876179 8:73442065-73442087 CCACTGCGCCTGGCCTAAATGGG - Intronic
1042892734 8:73631066-73631088 CCACTGTGCCTGGCCTAGATTGG - Intronic
1043110610 8:76175353-76175375 CCACTGCACCTGGCCAAAAGAGG + Intergenic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044534524 8:93344224-93344246 CCACTGTGCCCGGCCATAAAAGG + Intergenic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1044667798 8:94648931-94648953 CCACCGTGCCCAGCCAAAAATGG - Intronic
1045336639 8:101209960-101209982 CCACTGTGCCAGGCCAAAAAAGG + Intergenic
1045365385 8:101470852-101470874 ACACTGCGCCTGGCCAGAAATGG - Intergenic
1045470316 8:102506578-102506600 CCACTGTGCCTGGCCAGACTGGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045632793 8:104146075-104146097 CCACCGAGCCTGGCCCAAAAGGG - Intronic
1045782284 8:105881098-105881120 CCACCGCGCCTGGCCACAAAAGG + Intergenic
1045808572 8:106194404-106194426 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1046004863 8:108466739-108466761 CCACTGCACCTGGCCAAAATTGG + Intronic
1046462731 8:114563342-114563364 CCACTGTGCCTAACCAATAAGGG - Intergenic
1046637800 8:116691585-116691607 CCATTGTGCCTGGCCTAAAAGGG - Intronic
1047076755 8:121412546-121412568 CCACTGCGCCCGGCCAAACATGG + Intergenic
1047345865 8:124027847-124027869 CCATTGTGCCTGGCCTAAAATGG + Intronic
1047371264 8:124257940-124257962 CCACTGTGCCTGGCCAATGTGGG - Intergenic
1047679330 8:127237813-127237835 CCACTGCGCCCGGCCCAAAAGGG + Intergenic
1047790969 8:128203234-128203256 ACACAGTGCCTGGCCTAAAATGG + Intergenic
1047959474 8:130000403-130000425 CCCCTGTGCCTGGCCTAAATTGG - Intronic
1049133497 8:140871919-140871941 CCACTGTGCCTGGCCTAGTATGG - Intronic
1049155540 8:141064153-141064175 CCACTGTGCCTGGCCCGAATTGG + Intergenic
1049186205 8:141255365-141255387 CCACCGTGCCCAGCCAAAAAGGG + Intronic
1049753012 8:144294584-144294606 TTACTGAGCCTGGCCAGGAATGG + Intronic
1049775785 8:144403925-144403947 CCACTGTGCCCGGCCTCAAAAGG - Intronic
1049866268 8:144939316-144939338 CAACCGTGCCTGGCCCACAATGG - Intronic
1050052102 9:1613216-1613238 CCACTATGCCTGGCCATAATGGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050594557 9:7193049-7193071 CCACTGTGCCCAGGCAAAAATGG + Intergenic
1051444464 9:17125726-17125748 CCACCGTGCCTGGCCTCAAAGGG + Intergenic
1051510733 9:17875180-17875202 CCACTGCGCCTGGCCAGATATGG - Intergenic
1051599327 9:18856743-18856765 CCAGTGTGCCTGGCCCAAGAAGG + Intronic
1051839550 9:21379825-21379847 CTATAGTGCCTGGTCAAGAATGG - Intergenic
1051859045 9:21603463-21603485 GTACTGTTCCTGGGCAAAAAAGG - Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052832215 9:33225238-33225260 CTACTGTGCCTGGCCATAAGAGG + Intronic
1052869161 9:33486452-33486474 CTACTGCACCTGGTCAAGAAAGG - Intergenic
1053051947 9:34969352-34969374 CCACCGTGCCTGGCGAAAGAGGG - Intronic
1053140632 9:35680513-35680535 CCACTGTGCCTGGCCCCAAACGG + Intronic
1053301426 9:36953783-36953805 CTACTGCACCTGGCCAAGATAGG - Intronic
1053322709 9:37114412-37114434 CCACTGTGCCAGGCCAAAAGTGG + Intergenic
1053796786 9:41733885-41733907 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1054185199 9:61945960-61945982 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1054468150 9:65512078-65512100 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1054653310 9:67642536-67642558 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055112718 9:72575466-72575488 CCACTGTGCCTGGCCTGATAAGG + Intronic
1056637785 9:88345870-88345892 CCACTGAGCCAAGCCAAAAAAGG + Intergenic
1056638493 9:88350433-88350455 CCACTGTGCCTGGCCACAAAAGG - Intergenic
1056819146 9:89824835-89824857 CCACTGTGCCCAGCCAACAAGGG - Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1057288303 9:93778796-93778818 CCACTGTGCCCGGCCGGAAATGG + Intergenic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057544010 9:96002719-96002741 CCACTGTGCCTGGCCTAATTTGG + Intronic
1057689239 9:97268595-97268617 CCACTGCACCTGGCCAAGAAAGG + Intergenic
1057890014 9:98862901-98862923 CCACCGTGCCTGGCCACCAACGG + Intergenic
1057956406 9:99411737-99411759 CTTCTGGGCCTGGCCAAGAAGGG + Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058182815 9:101818372-101818394 CCACTGCGCCTGGCCAATAGTGG + Intergenic
1058391251 9:104497957-104497979 CCACTGCGCCTGGCCAAATGTGG - Intergenic
1059050612 9:110920833-110920855 CCACTGTGCCTGGCCACATTTGG - Intronic
1059073014 9:111159452-111159474 CTACTGTGCCAGGCCAACATAGG - Intergenic
1059082130 9:111261437-111261459 CTACTGTGCCTGGCCAGGGGAGG - Intergenic
1059543890 9:115157236-115157258 ATACTGTGCCTGGCCCAAAGTGG - Intronic
1060121612 9:120996104-120996126 CCACTGTGCCTGGCCAGAAGTGG + Intronic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060460332 9:123847127-123847149 CCACTGTGCCTGGCCATAAATGG + Intronic
1060503746 9:124182361-124182383 CCACTGTGCCTGGCCAAGTATGG - Intergenic
1060628007 9:125130768-125130790 CCACTGTGCCCGGCCAAGACTGG + Intronic
1060732135 9:126045486-126045508 CCACCGTGCCTGGCCACAGATGG - Intergenic
1060981950 9:127797854-127797876 CCACTGTGCCCGGCCACAAACGG + Intronic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061526168 9:131164681-131164703 CCACTGTGCCTTGCCGAAAAAGG + Intronic
1062222243 9:135423030-135423052 CCACTGTGCCTGGCCTGCAAAGG - Intergenic
1062247265 9:135575565-135575587 ACACTGTGCCCGGCCAAGAATGG - Intergenic
1062620447 9:137418057-137418079 CCACTGCGCCCGGCCACAAAAGG - Intronic
1062632497 9:137471311-137471333 CCACTGTGCCCGGCCATAAATGG - Intronic
1185498924 X:583192-583214 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1185739137 X:2516580-2516602 CCACTGCACCTGGCCAGAAAGGG - Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1185945924 X:4376090-4376112 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1186175401 X:6921095-6921117 CCACAGTGCCTGGCCATGAATGG - Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1187019486 X:15365418-15365440 CCGCTGCGCCTGGCCAACAATGG + Intronic
1187160990 X:16764984-16765006 CCACTGCACCTGGCCAAAAGTGG + Exonic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187326984 X:18300024-18300046 CCACTATGCCTGGCCAGAAAAGG + Intronic
1187387005 X:18858046-18858068 CCACCGCGCCCGGCCAAAAATGG + Intergenic
1187926839 X:24258360-24258382 CCACTGCGCCTGGCCCAAGAGGG + Intergenic
1187971629 X:24664668-24664690 CCACTGCACCTGGCCAAAGATGG - Intronic
1188033654 X:25292589-25292611 CCACCGTGCCTGGCCTTAAATGG + Intergenic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189902554 X:45722111-45722133 CCACTGCACCCGGCCAAAAATGG - Intergenic
1190016393 X:46831196-46831218 CCACAGTGCCTGGCCACACATGG - Intergenic
1190234170 X:48603358-48603380 CCACTGTGCCTGGCCGGAAAAGG - Intronic
1190273746 X:48886753-48886775 CCACTGTGCCCGGCCAACACAGG - Intergenic
1190410188 X:50129443-50129465 CCACTGCGCCTGGCCAGAAAAGG + Intergenic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1192120906 X:68454800-68454822 CCACCGAGCCTGGCCTAAAAAGG + Intergenic
1192313080 X:70032439-70032461 CTACTGAAACTGGCCAAAGATGG + Intronic
1192774295 X:74225748-74225770 CCACTGTGCCCGGCCAACAATGG + Intergenic
1193568432 X:83109902-83109924 CCACTGTGCCAGGCCACACAAGG + Intergenic
1193593166 X:83414684-83414706 CCACCGCGCCTGGCCTAAAATGG + Intergenic
1194587096 X:95748708-95748730 CCACCGTGCCTGGCCCCAAATGG + Intergenic
1194676430 X:96799520-96799542 CCACTGCGCCCGGCCAAGAAAGG - Intronic
1195081818 X:101378369-101378391 CCACCGTGCCTGGCCAGTAAAGG + Intronic
1195413119 X:104590330-104590352 CCACTGTGCCTGGCCTAAGTTGG + Intronic
1195498804 X:105569861-105569883 CTAATGTGGCTGTGCAAAAATGG - Intronic
1195612536 X:106884415-106884437 CCACTGTGCCCAGCCAAAAAGGG + Intronic
1196055640 X:111352010-111352032 CCACTGTGCCTGGCCTGCAATGG + Intronic
1196744615 X:119058828-119058850 CTACTGTGCCTGGTCTACAAGGG + Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196972247 X:121122328-121122350 CCACTGTGCCTGGCCTAGCATGG + Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197990354 X:132310862-132310884 CCACTGTGCCTGGCCAATGATGG - Intergenic
1198171968 X:134115906-134115928 CCACTGCACCTGACCAAAAATGG - Intergenic
1198248079 X:134850951-134850973 TTATTGTATCTGGCCAAAAATGG - Intronic
1198385920 X:136129345-136129367 CCTCTGTGCCTGGCCAAATTTGG - Intergenic
1198555488 X:137788887-137788909 CTCCTGTGCATGGACAAAGAAGG - Intergenic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1199464280 X:148118194-148118216 CCACTGTGCCTGGTCATATATGG - Intergenic
1199644415 X:149892496-149892518 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1199889059 X:152056862-152056884 CCACTGTGCCTGGCCTGGAATGG + Intergenic
1200181593 X:154154249-154154271 CCATTGTGCCTGGCCTATAATGG + Intronic
1200187241 X:154191363-154191385 CCATTGTGCCTGGCCTATAATGG + Intergenic
1200192890 X:154228503-154228525 CCATTGTGCCTGGCCTATAATGG + Intronic
1200198645 X:154266307-154266329 CCATTGTGCCTGGCCTATAATGG + Intronic
1200238306 X:154479737-154479759 CCACTTTGCCTGGCCTAAACTGG - Intergenic
1200300863 X:154974103-154974125 CCATTGAGCCTGGCCAAACAGGG + Intronic
1200771418 Y:7128935-7128957 CCACTGTGCCCAGCCAATAAAGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201733042 Y:17226246-17226268 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1202023698 Y:20496096-20496118 CTACTGTGCCTGTCCTAAATAGG - Intergenic
1202575956 Y:26324995-26325017 CTACCATACCTGGCCAAGAAGGG + Intergenic