ID: 1145125543

View in Genome Browser
Species Human (GRCh38)
Location 17:20297107-20297129
Sequence AGGACTCCTGCATTTCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145125543_1145125545 -2 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125545 17:20297128-20297150 CTAATTGATAAACCCCACTGTGG 0: 1
1: 0
2: 2
3: 12
4: 89
1145125543_1145125554 13 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125554 17:20297143-20297165 CACTGTGGGAGGGGGCTTACAGG 0: 1
1: 0
2: 1
3: 21
4: 166
1145125543_1145125555 30 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125555 17:20297160-20297182 TACAGGCCTGAAGTAGAAGTTGG 0: 1
1: 0
2: 1
3: 10
4: 143
1145125543_1145125546 -1 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125546 17:20297129-20297151 TAATTGATAAACCCCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 157
1145125543_1145125547 2 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125547 17:20297132-20297154 TTGATAAACCCCACTGTGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 140
1145125543_1145125550 5 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125550 17:20297135-20297157 ATAAACCCCACTGTGGGAGGGGG 0: 1
1: 0
2: 17
3: 297
4: 2235
1145125543_1145125549 4 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125549 17:20297134-20297156 GATAAACCCCACTGTGGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 105
1145125543_1145125548 3 Left 1145125543 17:20297107-20297129 CCTCTAAGAAATGCAGGAGTCCT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1145125548 17:20297133-20297155 TGATAAACCCCACTGTGGGAGGG 0: 1
1: 1
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145125543 Original CRISPR AGGACTCCTGCATTTCTTAG AGG (reversed) Intronic
902746623 1:18478852-18478874 AGGACACCTGACTTTCTAAGAGG + Intergenic
907186450 1:52612973-52612995 GGGACTCTTGCATGTATTAGAGG - Intergenic
909448212 1:75770918-75770940 AGGGCAGATGCATTTCTTAGAGG + Intronic
911270693 1:95797699-95797721 GGGACTGCTGCCTTTCTTTGAGG - Intergenic
914428286 1:147599190-147599212 GGGACTCCTGCACTTCGCAGAGG + Intronic
915325477 1:155079486-155079508 AGGACTCCTGCTTTTAAAAGTGG + Intronic
916483443 1:165235917-165235939 TGGCCTCTTGCATTTCTAAGGGG + Intronic
916669653 1:167003072-167003094 ACAACTCCTGCATCTCTTTGGGG + Intronic
919148647 1:193666952-193666974 AGGACTCCTGGGTTGCTTAAGGG - Intergenic
920219087 1:204382825-204382847 AGGACTTTTTCATTTGTTAGGGG - Intergenic
923154894 1:231269465-231269487 AGGCATCCTGCATTTCTCATTGG - Intronic
923436183 1:233970058-233970080 AGGACCCTTGCATTGCTGAGAGG - Intronic
923493501 1:234505241-234505263 AGGACTTCAGCATTTCTTCTTGG - Intergenic
1062856656 10:783263-783285 AGGAATCCTGTATTTCCTGGTGG - Intergenic
1062899472 10:1131523-1131545 TGGACTCCTGCATGTCCTTGGGG + Exonic
1063938239 10:11101134-11101156 ATGACTCTTGGATTTCTTACTGG + Intronic
1069071695 10:63996166-63996188 GGGAGCCCTGCATTTCTTTGGGG + Intergenic
1069944839 10:71978741-71978763 AGGAGCCCTGCATTCCCTAGAGG - Intronic
1070366310 10:75740550-75740572 ATGACTCTAGCACTTCTTAGTGG - Intronic
1072832133 10:98669995-98670017 ATGACTCCTTCATTTCTTTCAGG - Intronic
1074934933 10:118168922-118168944 AGGCTTCCTGCATTTCTTTTGGG - Intergenic
1075469517 10:122677739-122677761 AGAACTCCTGCATAACGTAGTGG - Intergenic
1076509442 10:131001905-131001927 AGGAAACATGCATTTCTAAGAGG - Intergenic
1079448792 11:20581365-20581387 AGGAAACCTCCATATCTTAGGGG - Intergenic
1079882470 11:25944405-25944427 AGGACTCCTGCCCTCCTGAGCGG - Intergenic
1080014730 11:27492293-27492315 AGGACTCCAACCTATCTTAGGGG + Intergenic
1083433111 11:62625181-62625203 AGAGCTGCTGCAATTCTTAGAGG - Exonic
1084510070 11:69597766-69597788 AGGACTCCAGCATCACTTAAGGG + Intergenic
1084935212 11:72583300-72583322 AGGCCTCCTGCCCTCCTTAGGGG - Intronic
1085836509 11:79962688-79962710 AGGACACCAGCATTTATCAGTGG - Intergenic
1088527072 11:110768343-110768365 TGAACTCCAGCATTACTTAGGGG + Intergenic
1088615254 11:111620078-111620100 TGGAATTCTGCATTTCTTACAGG + Intronic
1090153850 11:124414857-124414879 TGGATTCCTGCATTACTTAGTGG + Intergenic
1090433870 11:126669657-126669679 AGGACTCCTGCACTTCCTCGTGG + Intronic
1090868837 11:130725303-130725325 AGGGTGCCTGCATTTCTTGGTGG - Intergenic
1091309462 11:134562337-134562359 AGCTCTCATGCCTTTCTTAGGGG + Intergenic
1092048947 12:5454447-5454469 AGGACTCCAGCATATCTTGGTGG + Intronic
1093146933 12:15577848-15577870 AGGCCACCTGTATTTCTTGGAGG - Intronic
1099021314 12:77408004-77408026 GAGACTCCTGTATTTCTTAAAGG + Intergenic
1099662160 12:85577780-85577802 AGGAGTCCTGCTTCTTTTAGTGG + Intergenic
1100575201 12:95884914-95884936 AGGACTTCTACATATCTTTGTGG + Intronic
1104080221 12:125423462-125423484 AGGAGTCCTCCATTTCTTATAGG - Intronic
1104558505 12:129823369-129823391 AGGACACCTGCTTTTCTTCTAGG - Intronic
1104676058 12:130713332-130713354 AGGACACCTGCATCTCTTGTTGG - Intronic
1104676069 12:130713399-130713421 AGGACACCTGCATCTCTTGTTGG - Intronic
1108020248 13:46120864-46120886 TGGCCTCCTGTATTTCTAAGGGG + Intergenic
1108382938 13:49871599-49871621 AGGACTCCAACATATCTTTGTGG - Intergenic
1108485311 13:50917709-50917731 AGGACTCCTGCATGTGCCAGAGG + Intronic
1109663812 13:65502843-65502865 AGGGCTCCTGATTTTCTTTGAGG + Intergenic
1111997585 13:95180106-95180128 GGGACTCCTGTGTGTCTTAGTGG - Intronic
1112450563 13:99504423-99504445 AGGTATTTTGCATTTCTTAGAGG + Intronic
1113509512 13:110841779-110841801 AGGACTCCAGCATGTCTTTTTGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114802709 14:25796616-25796638 AGGACCCCTGCATTTCCTCAGGG + Intergenic
1117217599 14:53568035-53568057 AGGCCACCTGCATTTCTAACTGG - Intergenic
1118475825 14:66115961-66115983 ATGAGTCATGCATCTCTTAGTGG - Intergenic
1119200086 14:72745906-72745928 AGGACTCCTCCCTTTTTTGGGGG - Intronic
1123793820 15:23751724-23751746 AGGTATACTGCATTTCTTATAGG + Intergenic
1124180633 15:27470017-27470039 ATTCCTCCTGCATTTGTTAGTGG + Intronic
1127296078 15:57609585-57609607 AGGACTCCAGCATATCTTTTTGG + Intronic
1127811016 15:62565507-62565529 AGTACTCCTGGATTGCTTAAGGG + Intronic
1130940404 15:88503593-88503615 AGGAATACTGCATTTTTCAGAGG + Intergenic
1136428586 16:30184577-30184599 AGGGCACCTGCTTTTCTGAGCGG + Intronic
1137813823 16:51379170-51379192 AGGGCTCCTGTATTTCTGAAGGG - Intergenic
1138910837 16:61396929-61396951 ATGACTCCTTCATGTCTTAATGG + Intergenic
1143312124 17:6000988-6001010 AATACTCTTGCATTTCTTAGTGG - Intronic
1144027291 17:11289150-11289172 TTGACTCCTGCCTTTCTTAAGGG + Intronic
1145125543 17:20297107-20297129 AGGACTCCTGCATTTCTTAGAGG - Intronic
1154120797 18:11650933-11650955 AGGACTTCTGCATATGTTAAAGG + Intergenic
1154384549 18:13881079-13881101 AGGTCTCCTGCAGTCCCTAGAGG + Intergenic
1156240413 18:35248306-35248328 AGGCCTCCTGCTGTTCTTACTGG - Exonic
1162124283 19:8490858-8490880 AGGACTCCTGCTTAGCTCAGAGG + Intronic
1162207957 19:9070199-9070221 AGGGTTCCTGCATTCCTTAGGGG - Intergenic
1163810345 19:19427571-19427593 AGGACCCCTGCAATCTTTAGGGG + Intronic
1164481058 19:28611312-28611334 AGGGATCCTGCAATTATTAGAGG + Intergenic
1167249571 19:48392937-48392959 TGGACTCCTGCATCTATGAGGGG + Intergenic
928200188 2:29242957-29242979 AGGACTCCTGCAATTATTTCAGG - Intronic
929908601 2:46068938-46068960 GGAAATCCTGCATTTCTAAGAGG - Intronic
930888357 2:56354505-56354527 AGGCCTCATCCACTTCTTAGTGG - Intronic
931650955 2:64468281-64468303 AGAAATCCTACTTTTCTTAGGGG - Intergenic
939609382 2:144291275-144291297 AGGACTTCTACATTTCTTTTTGG + Intronic
940513642 2:154651243-154651265 TGGATTCCTGCCTTTCTTTGAGG - Intergenic
943764138 2:191642191-191642213 TGCACTCCTGAATTTCTGAGTGG + Intergenic
946473857 2:219989017-219989039 AGGACTTCAGCATATCTTTGGGG - Intergenic
947736066 2:232456190-232456212 AGGGCCCCTGCATGTCTTGGGGG - Exonic
948114637 2:235485314-235485336 AGGCCACCTGCATTCCTTGGTGG - Intergenic
1169980750 20:11381018-11381040 TGGAGTCCTGTATTTCTTGGAGG - Intergenic
1170025965 20:11890621-11890643 AGCACTCCCGCATCTCTGAGAGG - Intergenic
1171161040 20:22924078-22924100 AGAAATACTGAATTTCTTAGTGG - Intergenic
1173306966 20:41860104-41860126 TGTCCTCCTGCATTTCTTTGTGG + Intergenic
1173696359 20:45017949-45017971 ATGATTCCAGCAATTCTTAGTGG + Intronic
1177660807 21:24081392-24081414 AGGACTCCAACATCTCTTTGAGG - Intergenic
1181780189 22:25186888-25186910 AGGGCTCCAGCATTTCTCTGTGG + Intronic
957508292 3:81154842-81154864 GGGACTCCTGCAGTTCTCACAGG + Intergenic
960724234 3:120654054-120654076 AGCACTGCTGGATTTTTTAGGGG + Intronic
962965745 3:140352645-140352667 AAGACTGCTGTATTTCTTACAGG - Intronic
963437538 3:145289847-145289869 AGGACTCCCGCAGTCCTCAGAGG - Intergenic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
967185618 3:186942054-186942076 AGGACTTCTGCATTGCAGAGGGG + Intronic
967615248 3:191557255-191557277 AGGACTCCAGCATTTCCTGCAGG - Intergenic
970865442 4:20753327-20753349 GTGACTCCTGCATTTTATAGAGG + Intronic
970984181 4:22136443-22136465 AGTACACCTGCTTTTCTAAGAGG - Intergenic
971820451 4:31546976-31546998 AGGACTCCTGTTTTTCGTAATGG - Intergenic
973844876 4:54901429-54901451 AGGACTCCTGCCTTGGTTTGTGG - Intergenic
974948216 4:68553971-68553993 AGGACCACTGCATGTCATAGGGG - Intronic
975459401 4:74632886-74632908 ATGACTCCTGCATTTCTCAGAGG + Intergenic
978252922 4:106654931-106654953 AATTCTCCTGCTTTTCTTAGTGG + Intergenic
979993970 4:127408883-127408905 AGTACTCCTGTATTTTTTAGAGG - Intergenic
983052049 4:163060007-163060029 AAGACTCCTTCCTTTATTAGAGG + Intergenic
985526417 5:405085-405107 AGACCTGCTGCATTTCTTTGGGG - Intronic
987050045 5:14141695-14141717 AGGGCTCCTCCATTTCATGGAGG + Intergenic
990098683 5:52155070-52155092 AGGACTACTGGATTTCTGACAGG + Intergenic
995834607 5:116387539-116387561 AGGCCACCTGCATTTCTTTAGGG + Intronic
996888396 5:128387274-128387296 AGGATTTCTGTATTTCTTTGGGG + Intronic
997670356 5:135666292-135666314 AGAACTTCTCCATTTATTAGAGG + Intergenic
999929780 5:156418636-156418658 AGGACTCCTCCATCTCCTTGTGG - Intronic
1002929478 6:1623645-1623667 AGGACTCCTGCAAGGCTAAGGGG - Intergenic
1003867222 6:10374403-10374425 AGGACTGCTGCAGTTTTTCGAGG + Intergenic
1004530515 6:16450837-16450859 TGGACACCTGTATTTCTGAGAGG - Intronic
1009766432 6:68082372-68082394 AGGACTCCTTCAAATCTTATAGG + Intergenic
1010741142 6:79506575-79506597 AAGACTGCACCATTTCTTAGTGG - Intronic
1018319913 6:162596981-162597003 AGGAGCCCTGCATTTCTTGAAGG - Intronic
1019191752 6:170255266-170255288 AGGTCTTCTCCATTTCTCAGAGG - Intergenic
1020576364 7:9934583-9934605 TTCACTCCTACATTTCTTAGAGG + Intergenic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1021502514 7:21346347-21346369 AGGACTCAGGCCTTTCTTTGGGG - Intergenic
1021616012 7:22504082-22504104 AGCACTCAGGAATTTCTTAGTGG + Intronic
1024088830 7:45919471-45919493 ATGAATCCAGCATTTCTCAGGGG + Intronic
1024838855 7:53559889-53559911 AGGAGTCCTGCTTCTTTTAGTGG - Intergenic
1028376462 7:90150260-90150282 AGCACTCAGGAATTTCTTAGTGG - Intergenic
1029823809 7:103169978-103170000 AGCACTCAGGAATTTCTTAGTGG + Intergenic
1034104798 7:148481212-148481234 AGATCACCTCCATTTCTTAGGGG - Intergenic
1041749838 8:61248760-61248782 AGGACTTCTGGGTGTCTTAGAGG - Intronic
1042206787 8:66337646-66337668 AGGACTCCAGCATATCTTTTTGG + Intergenic
1043852303 8:85228938-85228960 AGGACACCTGCATGTCATGGAGG - Intronic
1044341751 8:91054158-91054180 AGGAATTCTGCATTCCTTTGTGG + Intergenic
1048437594 8:134432539-134432561 AGGATTCTTGCATTTCTGGGTGG - Intergenic
1051164492 9:14247456-14247478 AGGACTACTCCATTTCTCACAGG + Intronic
1051986810 9:23098970-23098992 AGGTCTCCTTCATTCCTAAGAGG + Intergenic
1055088687 9:72340287-72340309 AGGACTCCAGCATATCTTTTTGG - Intergenic
1056458227 9:86784088-86784110 AGCTCTCCTGAATTTCTCAGTGG - Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057036812 9:91817304-91817326 AGGTCTCCTGCCTTCCTTGGTGG - Intronic
1057858090 9:98617699-98617721 AGGTCTCCTGCATTCACTAGAGG - Intronic
1060213079 9:121722328-121722350 AGGAGTCCTGCATTGTTCAGAGG + Intronic
1061805082 9:133133333-133133355 GGGACTCCTGCATTTCTGCGTGG - Intronic
1186715766 X:12249643-12249665 AGGCATCCCGCTTTTCTTAGAGG - Intronic
1187253694 X:17622484-17622506 GGGACTCCTGCTTTTGTTGGAGG - Intronic
1190472876 X:50800449-50800471 AGAACTCCGGCATTTCAGAGGGG + Intronic
1194261259 X:91699160-91699182 AGGACTGCTGCATTTCTGCATGG + Intergenic
1194412214 X:93571236-93571258 AGGACTGCTGCATGTCACAGGGG + Intergenic
1199877750 X:151948261-151948283 ATAACTACTTCATTTCTTAGTGG + Intergenic
1200156947 X:153981892-153981914 AGGACTCCTGCCTTCCTTCGGGG + Exonic
1200579908 Y:4937961-4937983 AGGACTGCTGCATTTCTGCATGG + Intergenic
1202162419 Y:21948976-21948998 AGGGCTTCTGCATTTTTTTGGGG + Intergenic
1202228937 Y:22637397-22637419 AGGGCTTCTGCATTTTTTTGGGG - Intergenic
1202314217 Y:23558768-23558790 AGGGCTTCTGCATTTTTTTGGGG + Intergenic
1202556585 Y:26111827-26111849 AGGGCTTCTGCATTTTTTTGGGG - Intergenic