ID: 1145130122

View in Genome Browser
Species Human (GRCh38)
Location 17:20337547-20337569
Sequence TCTAGGTATCTCCTTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145130122_1145130127 -6 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130127 17:20337564-20337586 CCTAGATACCTGTTTACCTGGGG No data
1145130122_1145130131 10 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130131 17:20337580-20337602 CCTGGGGAAAGATGAGGATGAGG No data
1145130122_1145130124 -8 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130124 17:20337562-20337584 TACCTAGATACCTGTTTACCTGG No data
1145130122_1145130125 -7 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130125 17:20337563-20337585 ACCTAGATACCTGTTTACCTGGG No data
1145130122_1145130129 4 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130129 17:20337574-20337596 TGTTTACCTGGGGAAAGATGAGG No data
1145130122_1145130132 11 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145130122 Original CRISPR TCTAGGTATCTCCTTCCTTA GGG (reversed) Intergenic
No off target data available for this crispr