ID: 1145130126

View in Genome Browser
Species Human (GRCh38)
Location 17:20337564-20337586
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145130126_1145130132 -6 Left 1145130126 17:20337564-20337586 CCTAGATACCTGTTTACCTGGGG No data
Right 1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG No data
1145130126_1145130131 -7 Left 1145130126 17:20337564-20337586 CCTAGATACCTGTTTACCTGGGG No data
Right 1145130131 17:20337580-20337602 CCTGGGGAAAGATGAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145130126 Original CRISPR CCCCAGGTAAACAGGTATCT AGG (reversed) Intergenic
No off target data available for this crispr