ID: 1145130127

View in Genome Browser
Species Human (GRCh38)
Location 17:20337564-20337586
Sequence CCTAGATACCTGTTTACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145130122_1145130127 -6 Left 1145130122 17:20337547-20337569 CCCTAAGGAAGGAGATACCTAGA No data
Right 1145130127 17:20337564-20337586 CCTAGATACCTGTTTACCTGGGG No data
1145130123_1145130127 -7 Left 1145130123 17:20337548-20337570 CCTAAGGAAGGAGATACCTAGAT No data
Right 1145130127 17:20337564-20337586 CCTAGATACCTGTTTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145130127 Original CRISPR CCTAGATACCTGTTTACCTG GGG Intergenic