ID: 1145130805

View in Genome Browser
Species Human (GRCh38)
Location 17:20346562-20346584
Sequence CTCACTCCAATCCACAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145130805_1145130807 13 Left 1145130805 17:20346562-20346584 CCAGGCTTGTGGATTGGAGTGAG No data
Right 1145130807 17:20346598-20346620 GGCTGTCTTTCCGAAGCAAGTGG No data
1145130805_1145130809 29 Left 1145130805 17:20346562-20346584 CCAGGCTTGTGGATTGGAGTGAG No data
Right 1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG No data
1145130805_1145130806 -8 Left 1145130805 17:20346562-20346584 CCAGGCTTGTGGATTGGAGTGAG No data
Right 1145130806 17:20346577-20346599 GGAGTGAGTTTGTGTTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145130805 Original CRISPR CTCACTCCAATCCACAAGCC TGG (reversed) Intergenic
No off target data available for this crispr