ID: 1145130809

View in Genome Browser
Species Human (GRCh38)
Location 17:20346614-20346636
Sequence CAAGTGGTCCACATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145130805_1145130809 29 Left 1145130805 17:20346562-20346584 CCAGGCTTGTGGATTGGAGTGAG No data
Right 1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG No data
1145130804_1145130809 30 Left 1145130804 17:20346561-20346583 CCCAGGCTTGTGGATTGGAGTGA No data
Right 1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145130809 Original CRISPR CAAGTGGTCCACATTGATAT TGG Intergenic
No off target data available for this crispr