ID: 1145134487

View in Genome Browser
Species Human (GRCh38)
Location 17:20389320-20389342
Sequence CAGGATAAAGTCACTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145134487_1145134489 4 Left 1145134487 17:20389320-20389342 CCACTTACAGTGACTTTATCCTG No data
Right 1145134489 17:20389347-20389369 AACCACCCCTGTAAGCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145134487 Original CRISPR CAGGATAAAGTCACTGTAAG TGG (reversed) Intergenic
No off target data available for this crispr