ID: 1145139785

View in Genome Browser
Species Human (GRCh38)
Location 17:20442699-20442721
Sequence CGCCCACACCACGGCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145139785_1145139794 13 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139794 17:20442735-20442757 AGTTTGCGCATGGGCAGTGGGGG No data
1145139785_1145139795 14 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139795 17:20442736-20442758 GTTTGCGCATGGGCAGTGGGGGG No data
1145139785_1145139791 10 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139791 17:20442732-20442754 TACAGTTTGCGCATGGGCAGTGG No data
1145139785_1145139790 4 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139790 17:20442726-20442748 AGCTGGTACAGTTTGCGCATGGG No data
1145139785_1145139796 21 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139796 17:20442743-20442765 CATGGGCAGTGGGGGGACGTTGG No data
1145139785_1145139789 3 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG No data
1145139785_1145139793 12 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139793 17:20442734-20442756 CAGTTTGCGCATGGGCAGTGGGG No data
1145139785_1145139792 11 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139792 17:20442733-20442755 ACAGTTTGCGCATGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145139785 Original CRISPR CGCCCACACCACGGCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr