ID: 1145139789

View in Genome Browser
Species Human (GRCh38)
Location 17:20442725-20442747
Sequence CAGCTGGTACAGTTTGCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145139787_1145139789 -6 Left 1145139787 17:20442708-20442730 CCGTGGTGTGGGCGGAGCAGCTG No data
Right 1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG No data
1145139780_1145139789 18 Left 1145139780 17:20442684-20442706 CCTGAGTGGGGGCGTCCAAGGAG No data
Right 1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG No data
1145139778_1145139789 28 Left 1145139778 17:20442674-20442696 CCTGAGAGTGCCTGAGTGGGGGC No data
Right 1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG No data
1145139785_1145139789 3 Left 1145139785 17:20442699-20442721 CCAAGGAGGCCGTGGTGTGGGCG No data
Right 1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145139789 Original CRISPR CAGCTGGTACAGTTTGCGCA TGG Intergenic
No off target data available for this crispr