ID: 1145145099

View in Genome Browser
Species Human (GRCh38)
Location 17:20473411-20473433
Sequence CATCAGAGGGAGGGTGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145145099_1145145111 20 Left 1145145099 17:20473411-20473433 CCTCCCGCACCCTCCCTCTGATG No data
Right 1145145111 17:20473454-20473476 TTGTCCAGCCATTTGCTCAAGGG No data
1145145099_1145145106 -7 Left 1145145099 17:20473411-20473433 CCTCCCGCACCCTCCCTCTGATG No data
Right 1145145106 17:20473427-20473449 TCTGATGAGCCCTATTCCTGAGG No data
1145145099_1145145110 19 Left 1145145099 17:20473411-20473433 CCTCCCGCACCCTCCCTCTGATG No data
Right 1145145110 17:20473453-20473475 ATTGTCCAGCCATTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145145099 Original CRISPR CATCAGAGGGAGGGTGCGGG AGG (reversed) Intergenic
No off target data available for this crispr