ID: 1145147047

View in Genome Browser
Species Human (GRCh38)
Location 17:20491366-20491388
Sequence CAGTGTTAGCTGCTGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145147042_1145147047 10 Left 1145147042 17:20491333-20491355 CCTACATTTCATAATAGAAAACC No data
Right 1145147047 17:20491366-20491388 CAGTGTTAGCTGCTGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145147047 Original CRISPR CAGTGTTAGCTGCTGGAATA AGG Intergenic
No off target data available for this crispr