ID: 1145147293

View in Genome Browser
Species Human (GRCh38)
Location 17:20492995-20493017
Sequence CTGTGTGGCTAAAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145147283_1145147293 19 Left 1145147283 17:20492953-20492975 CCTGAGGTGGAAACAAGCAAAGT No data
Right 1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG No data
1145147288_1145147293 -9 Left 1145147288 17:20492981-20493003 CCAGGGTAGGAGTCCTGTGTGGC No data
Right 1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145147293 Original CRISPR CTGTGTGGCTAAAGGGCAGT GGG Intergenic
No off target data available for this crispr