ID: 1145153653

View in Genome Browser
Species Human (GRCh38)
Location 17:20526158-20526180
Sequence CAGTGTTAGCTGCTGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145153653_1145153658 10 Left 1145153653 17:20526158-20526180 CCTTATTCCAGCAGCTAACACTG No data
Right 1145153658 17:20526191-20526213 GGTTTTCTATTATGAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145153653 Original CRISPR CAGTGTTAGCTGCTGGAATA AGG (reversed) Intergenic
No off target data available for this crispr