ID: 1145155600

View in Genome Browser
Species Human (GRCh38)
Location 17:20543893-20543915
Sequence GATCCTCTGTTCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145155600_1145155603 -6 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155603 17:20543910-20543932 AGGATCATGAGGACAGTGTGAGG No data
1145155600_1145155605 8 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155605 17:20543924-20543946 AGTGTGAGGAAGCTGCCCTTGGG No data
1145155600_1145155604 7 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155604 17:20543923-20543945 CAGTGTGAGGAAGCTGCCCTTGG No data
1145155600_1145155610 29 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155610 17:20543945-20543967 GGCCAGTCGGGTCTGACCGCAGG No data
1145155600_1145155607 17 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155607 17:20543933-20543955 AAGCTGCCCTTGGGCCAGTCGGG No data
1145155600_1145155606 16 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155606 17:20543932-20543954 GAAGCTGCCCTTGGGCCAGTCGG No data
1145155600_1145155611 30 Left 1145155600 17:20543893-20543915 CCTCTGGGCCAGAACAGAGGATC No data
Right 1145155611 17:20543946-20543968 GCCAGTCGGGTCTGACCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145155600 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG (reversed) Intergenic