ID: 1145156554

View in Genome Browser
Species Human (GRCh38)
Location 17:20548544-20548566
Sequence CTGGGACCACCTGGAGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145156554_1145156560 6 Left 1145156554 17:20548544-20548566 CCTTGAGCTCCAGGTGGTCCCAG No data
Right 1145156560 17:20548573-20548595 ATTCAGATTCCCTCCCAGCAAGG No data
1145156554_1145156565 25 Left 1145156554 17:20548544-20548566 CCTTGAGCTCCAGGTGGTCCCAG No data
Right 1145156565 17:20548592-20548614 AAGGTGACGCTTGCACGAATAGG No data
1145156554_1145156566 29 Left 1145156554 17:20548544-20548566 CCTTGAGCTCCAGGTGGTCCCAG No data
Right 1145156566 17:20548596-20548618 TGACGCTTGCACGAATAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145156554 Original CRISPR CTGGGACCACCTGGAGCTCA AGG (reversed) Intergenic